Labshake search
Citations for New England Biolabs :
351 - 400 of 4672 citations for High mobility group protein B1 HMGB1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... using the high-fidelity Phusion DNA polymerase (NEB) and cloning into the pJR1-41XL vector116 with the CloneEZ PCR Cloning Kit (GenScript) ...
-
bioRxiv - Genetics 2024Quote: ... with Phusion high-fidelity DNA Polymerase Kit (NEB), Common sgRNA-R and Primer 1 or Primer 2 (see below).
-
bioRxiv - Microbiology 2024Quote: ... 7.5µl 2x NEBNext High Fidelity Master Mix (NEB), and 1.25µl of each barcoded Nextera N5x and N7x index primers per reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... Q5® High-Fidelity DNA Polymerase (NEB #M0491S) and Phusion® High-Fidelity DNA Polymerase (NEB #M0530S ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR using Q5 High-Fidelity DNA polymerase (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... or Q5 High-Fidelity 2X Master Mix (NEB), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... high-fidelity PCR reactions (NEB Q5 DNA Polymerase) with pBSV2G and pcon++flgV were performed using primers PA470 + PA467 and PA466 + PA467 ...
-
bioRxiv - Cell Biology 2024Quote: ... or Amylose Resin High Flow (New England Biolabs) respectively according to the manufacturers’ instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... PCR reactions with Q5 high fidelity polymerase (NEB) were carried out as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... fully assembled complexes containing His-Rpn12 and MBP-Rpn6 were purified using a HisTrap and amylose resin (NEB), and cleaved with HRV-protease ...
-
bioRxiv - Cell Biology 2020Quote: ... Igκ-LaNtα31-Myc-His was excised from pGEM®-5Zf(+)-LaNtα31 using NdeI and NsiI (New England Biolabs) and inserted into phK14-mCherry ...
-
bioRxiv - Microbiology 2022Quote: ... Tagmented DNA was amplified by PCR using 1x NEBNext Hi-Fidelity PCR Master Mix (New England Biolabs, NEB), using Nextera Index i5 and i7 series PCR primers ...
-
bioRxiv - Microbiology 2022Quote: ... Tagmented DNA was amplified by PCR using 1x NEBNext Hi-Fidelity PCR Master Mix (New England Biolabs, NEB), using Nextera Index i5 and i7 series PCR primers ...
-
bioRxiv - Bioengineering 2023Quote: ... GLuc was inserted into the digested backbone through Gibson Assembly Hi-Fi kit (New England Biolabs, Ipswich, MA). AAV-hSyn-hM3Dq-RAM-d2tTA was constructed as previously described19 ...
-
bioRxiv - Microbiology 2023Quote: ... Purified PCR products were incubated together in a thermocycler with 1X Hi-Fi DNA Assembly master mix (NEB) at 50°C for one hour ...
-
bioRxiv - Cell Biology 2023Quote: ... sequences of all myc-his tagged RBPs were digested using ClaI and PmeI restrictions enzymes (New England Biolabs), blunted using DNA polymerase I large Klenow fragment (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was used to construct high-throughput sequencing libraries using NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs M0541). DNA libraries were processed on a Illumina NextSeq machine for paired-end 41-nt sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... PCRs were performed using Q5 High Fidelity polymerase or Phusion High Fidelity polymerase (both from New England Biolabs, Ipswich, Massachusetts, USA), and analytic PCRs were performed using MasterMix (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was diluted 1/8 in nuclease-free water and used as template for a first touch-down RT-PCR reaction primed with a high-specificity primer (71°C annealing Tm) and a universal reverse primer using Q5 High-Fidelity polymerase (New England Biolabs, USA). The PCR product of this first RT-PCR was then diluted 1/100 in nuclease-free water and used as a template for a semi-nested RT-PCR using a gene-specific primer and the universal reverse primer ...
-
bioRxiv - Biochemistry 2022Quote: mRNA synthesis via in vitro transcription was performed using linearized plasmid DNA using High Scribe T7 Polymerase HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs): 100 mM NTPs ...
-
bioRxiv - Genomics 2020Quote: ... Touhc-down PCR was used to amplify 200ng of cDNA with Q5 High-Fidelity DNA Polymerase and the High-GC content buffer (New england Biolabs, #M0491L) and primers listed in Supplementary Table S4 on a BioRad T100 Thermal Cycler (BioRad ...
-
bioRxiv - Biochemistry 2022Quote: ... protein was treated overnight with Lambda Protein Phosphatase (NEB #P0753S) at 4 °C.
-
bioRxiv - Neuroscience 2021Quote: ... Cas9 protein (NEB) was mixed with all six sgRNAs and injected into embryos at the 1-cell stage ...
-
bioRxiv - Plant Biology 2024Quote: ... SpCas9 protein (NEB), 1 x cut smart buffer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome were amplified using the high-fidelity proofreading enzyme Q5® High-Fidelity DNA Polymerase (NEB, M0491L) in a 25 µL reaction volume using respective primers (fig ...
-
bioRxiv - Biochemistry 2021Quote: Toxins were expressed with (His)6-tags at their C-termini in competent C43 (DE3) Escherichia coli cells (NEB) for HlgA and in BL21 (DE3 ...
-
bioRxiv - Biochemistry 2021Quote: LCB1 was synthesized and cloned into E.coli using a pET expression vector via Hi-Fi DNA assembly (NEB; E2621S) with a gBlock (ITD ...
-
bioRxiv - Immunology 2021Quote: ... Restriction digest of EtMIC3 PCR product was performed using Bam HI and Eco RI restriction enzymes (New England Biolabs) to extract antigen coding sequence for cloning into pYD1 plasmid vector ...
-
bioRxiv - Biophysics 2020Quote: ... The point mutants were subsequently cloned in the pNZopuAHis plasmid (C-terminal 6-HIS-tag) using EcoRV-AlnwnI (NEB) for the substrate-binding domain mutants and βamHI-AlwnI (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.
-
bioRxiv - Genomics 2021Quote: ... the Hi-C library was amplified for about 10 cycles of PCR with the Q5 master mix (NEB, M0492L), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 404–561 with a C terminal His tag added was cloned into the pMAL-c5x vector (New England Biolabs), and were transformed in E ...
-
bioRxiv - Molecular Biology 2023Quote: The following M35 derivative constructs were derived from pcDNA3.1 TOPO M35-V5/His using the Q5 site-directed mutagenesis kit (#E0554, New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Near full-length 16S rRNA genes were amplified by PCR using Phusion Hi-Fidelity DNA Polymerase (New England BioLabs) and a bacteria-specific primer set ...
-
bioRxiv - Neuroscience 2023Quote: ... These two amplicons were incubated with SfoI digested pET23a-His-TEV plasmid in a HiFi Assembly reaction (NEB, E2621S) to generate a plasmid where HaloTag and SpyCatcher3 is linked with a GSGESGSG linker sequence.
-
bioRxiv - Genomics 2023Quote: Hi-C single-index library preparation of MCF7 cells was performed as previously described using MboI (New England Biolabs) restriction enzyme (30).
-
bioRxiv - Microbiology 2023Quote: ... Gibson assemblies were completed using a 2x HI-FI Assembly master mix following the manufacturer’s protocol (New England Biolabs). PCR clean-up was done using the GeneJET PCR Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... pCAGEN_6×His-DNAJA2-HA was created from PCR of the ORF from pColdI_6×His-DNAJA2 and insertion into EcoRI-digested pCAGEN plasmids using NEBuilder HiFi DNA Assembly Master Mix (NEB). This plasmid was then used to produce pCAGEN_3xFLAG-DNAJA2 in a similar manner ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA was extracted from organoids (three biological replicates for each group) by TRIzol and the rRNAs were removed with NEBNext rRNA Depletion Kit (New England Biolabs, Inc., Massachusetts, USA). RNA libraries were constructed using the NEBNext® Ultra(tm ...
-
bioRxiv - Plant Biology 2020Quote: ... Phusion high fidelity DNA polymerase (Phusion) (New England Biolabs) and the proofreading DreamTaq DNA-Polymerase (DreamTaq ...