Labshake search
Citations for New England Biolabs :
351 - 400 of 4441 citations for 3' 5' Dimethyl 3 2 3 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µl of T4 polynucleotide kinase (NEB, M0201L) and 4 µl of terminal deoxynucleotidyl transferase (Enzymatics ...
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µL volume of USER Enzyme (NEB, USA) was applied to the size-selected ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3 µl 1,000 U/µl USER Enzyme (NEB), Ultrapure water (Thermo ...
-
bioRxiv - Immunology 2024Quote: ... and T4 PNK 3′ phosphatase minus (NEB, M0236L) at 37°C for 10 min ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 37°C for 10 min and heat inactivated at 80°C for 2 min ...
-
bioRxiv - Bioengineering 2024Quote: ... for fragments <3 kb and Q5 (M0492, NEB) for fragments >3 kb ...
-
bioRxiv - Bioengineering 2024Quote: GGATCC-3’ and 1x ThermoPol Reaction Buffer (NEB), 10 units of Taq DNA polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3’ exonuclease activity of Klenow polymerase (NEB M0210) was done also at 37 °C for 30 minutes while shaking ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Biophysics 2022Quote: ... The gene sequences were flanked by restriction enzyme sites for 5’ NdeI and 3’ EcoRI (NEB). Genes were cloned into pET21a using standard protocols from NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by dA tailing with 0.25 U/µL Klenow (3′→5′ exo-) (New England Biolabs, M0212) in the presence of 0.5 mM dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was 5’-labelled with 20 U of T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB # M0236S) and 50 pmol of (gamma-32P)ATP (Perkin Elmer ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse: 5’-GCTGCCAGTCCAATAGAGGG-3’) were used with the Luna Universal One-Step RT-qPCR Kit (NEB) with SYBR Green detection on the CFX96 (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Molecular Biology 2021Quote: ... A preadenylated universal linker (5’-rAppCTGTAGGCACCATCAAT-NH2-3’) was prepared in house or purchased from NEB (S1315S) and ligated to the 3’ ends of the dephosphorylated footprints using T4 RNA Ligase 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... two oligos (see Supplementary Table 3) were annealed and 5’ phosphorylated (T4 Polynucleotide Kinase kit, M0201S, NEB) as described previously (LentiGuide-Puro and LentiCRISPRv2) ...
-
m7G cap-eIF4E interaction stimulates polysome formation by enhancing first-round initiation kineticsbioRxiv - Biophysics 2021Quote: ... 5’-end capping and 3’-end biotinylation were performed using the Vaccinia Capping System (New England Biolabs) and the Pierce RNA 3’ End Biotinylation Kit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µl Antarctic phosphatase [5 U] and 7.32 µl Antarctic phosphatase buffer (both New England BioLabs, Germany). The reaction was heat-inactivated at 85°C during 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... as follows: 1µL of 2µM MBTUni-12 primer (5’-ACGCGTGATCAGCRAAAGCAGG-3’) + 1µL 10mM dNTPs Mix (NEB #N0447S) + 8µL Nuclease-free water (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer Y111E: 5’-TTGATGGAGACATTCTTC-3’) using the Q5 site-directed mutagenesis kit (E0554S, New England Biolabs) to generate a point mutant ...
-
bioRxiv - Biophysics 2021Quote: ... 5′-end capping and 3′-end biotinylation were performed using the Vaccinia Capping System (New England Biolabs) and the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA fragments were directly 3’-end dephosphorylated using 5 U of Antarctic Phosphatase (New England Biolabs, UK) for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... which was dephosphorylated at the 5’-end with 3 µl of Quick-CIP (5000 U/µl, NEB) in a total volume of 20 µl according to manufactureŕs instructions ...
-
bioRxiv - Microbiology 2023Quote: ... CVO689-CVO586 (integrant 5’ end) and CVO321-CVO183 (integrant 3’ end) using Q5 Polymerase (New England Biolabs). PCRs were set up according to manufacturers’ instructions ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...