Labshake search
Citations for New England Biolabs :
201 - 250 of 4441 citations for 3' 5' Dimethyl 3 2 3 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 to 3 μg plasmid was digested with 1 μl NotI (NEB) for 1 h at 37 °C and heat inactivated prior to transformation ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5 μl Klenow fragment (3′ to 5′ exo-, Cat. #M0212L; New England Biolabs) and 0.5 μl T4 Polynucleotide Kinase (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Microbiology 2024Quote: ... with 5 μl of 5 mM 3’ -desthiobiotin-guanosine triphosphate (DTB-GTP) (NEB product number N0761), 5 μl vaccinia capping enzyme (NEB product number M2080) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 μL of QuickCIP (NEB). The reaction was incubated at 27°C for 20 minutes followed by inactivation at 80°C for 2 minutes ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL BsiWI-HF (NEB, R3553), 3 µL MluI-HF (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL MluI-HF (NEB, R3198), and nuclease-free water to 150 µL at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of XbaI (NEB R0145S) was used to digest 6 μg of the pcDNA3.1-Cas9 vector ...
-
bioRxiv - Genomics 2024Quote: ... 3 µL 10x ThermoPol buffer (NEB), 3 µL H2O and Therminator IX (NEB 10 U/µL ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl of USER (NEB # E7103L) was added for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...