Labshake search
Citations for New England Biolabs :
3801 - 3850 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... using the Monarch Genomic DNA Purification Kit following the manufacturer’s protocol (New England Biolabs). The targeted region in NEAT1 was amplified by PCR (primers in Extended Data Table 2) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After gel extraction using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) Gibson Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Library Prep Kit for Illumina (NEB) and paired-end sequencing was performed using an Illumina Novaseq instrument.
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal RNA was depleted from total RNA with the rRNA depletion kit (NEB# E6310) and subsequently prepared for RNA-seq with the NEBNext Ultra Directional RNA Library Prep Kit (NEB #E7420 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified gDNA was subsequently processed using the EpiMark 5hmC Analysis kit (NEB, cat# E3317) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Point mutants were generated using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Plant Biology 2023Quote: ... desalted using GenepHlow PCR Cleanup Kit (GeneAid) and ligated with T4 DNA ligase (NEB), each step according to manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... the PCR reaction was purified using the Monarch PCR Cleanup Kit (New England Biolabs). DNA was sent for Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared using NEBNext Ultra DNA Library Prep Kit Illumina (NEB) and sequenced on the Illumina HiSeq 2500 platform (PE 50bp) ...
-
bioRxiv - Genetics 2023Quote: Sequencing library was constructed by NEBNext ultra II DNA library prep kit (NEB E7103L). 50 million paired-end 50bp reads were obtained for each ChIP and input sample using a NextSeq 2000 instrument ...
-
bioRxiv - Genetics 2023Quote: ... and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs). After mutagenesis ...
-
bioRxiv - Genetics 2023Quote: ... We performed cDNA synthesis from RNA using LunaScript RT Supermix Kit (New England Biolabs) beginning with 500ng of RNA ...
-
bioRxiv - Genomics 2023Quote: ... followed by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 (NEB# E6440) ...
-
bioRxiv - Genomics 2023Quote: ... The homology vector was cloned by Gibson assembly (Gibson Assembly Master Mix kit, NEB) into a restriction-enzyme digested pCAG backbone plasmid ...
-
bioRxiv - Microbiology 2023Quote: PCR products were routinely purified using Monarch® PCR & DNA clean-up kit (NEB), or E.Z.N.A.® Cycle Pure Kit (Omega Bio-Tek ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was then purified using the Monarch RNA Cleanup Kit (NEB, Cat. No. T2040).
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon gel extraction following the Monarch® DNA Gel Extraction Kit (NEB, Frankfurt, Germany) instructions was used to isolate and purify the cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the cDNA libraries were purified using the Monarch PCR & DNA Cleanup Kit (NEB). High-throughput sequencing was performed on an Illumina NextSeq 550 in paired-end mode with 150 cycles per end.
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were constructed using NEBNext library kits (New England Biolabs, Ipswich, MA, USA) and sequenced on a NextSeq 550 sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... The transcripts were purified with a Monarch RNA Cleanup kit (New England Biolabs, USA). The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... transferred to 50 μl DNA/RNA protection buffer (Monarch Total RNA Miniprep Kit, NEB), and stored in liquid N2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Kit for Illumina (NEB) and sequenced with an Illumina Novaseq 6000 system to produce 50 bp paired-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... libraries were prepared using NEBNext Ultra kit (New England Biolabs #E7490, #E7770, #E7335, #E7500) and sequenced using a Nextseq500/550 sequencer ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Gibson Assembly Cloning Kit as instructed by the manufacturer (New England BioLabs). The resulting vector was termed pCEP4-MFAP4 coding for the amino acid sequence M1KAL…IRRA255 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were selected using the NEB Next Poly A+ Isolation Kit (NEB #E7490S/L). Poly A+ fractions were eluted ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel purification using the Monarch DNA Gel Extraction Kit (New England BioLabs Inc. #T1020L) was performed to extract the shRNA sequence and column purification with the QIAprep PCR Purification Kit (Qiagen #28104 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBNext® UltraTM FS II Library Prep kit (New England Biolabs) with default parameters ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was preferred ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Molecular Biology 2023Quote: Libraries for ChIP-seq were prepared with NEBNext Ultra II DNA Library kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Biophysics 2023Quote: ... The NEBuilder HiFi DNA Assembly and Q5 site-directed mutagenesis kits (New England Biolabs) were used for plasmid construction ...
-
bioRxiv - Biophysics 2023Quote: RNA synthesis was performed according to the HiScribe SP6 RNA Synthesis Kit protocol (NEB). Double-stranded DNA sequences containing SP6 promoter 5′ATTTAGGTGTGACACTATAG 3′ were used as DNA matrixes for RNA transcription.
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2023Quote: ... we utilized the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: ... and processed with the NEBNext Ultra II DNA library preparation kit (New England Biolabs). Sequencing was performed on MiSeq sequencers (Illumia) ...
-
bioRxiv - Molecular Biology 2023Quote: DNA from positive clones was extracted using a Monarch Genomic DNA Purification kit (NEB). DNA insertion was confirmed by amplification of a fragment including both genomic and kanamycin resistance cassette sequences followed by the sequencing of amplified DNA (Macrogen).
-
bioRxiv - Cell Biology 2024Quote: ... after ribosomal RNA (rRNA) depletion using an NEBNext rRNA Depletion Kit (New England Biolabs). Paired-end (2 × 36 bases ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted using NEB Monarch Total RNA miniprep kit (NEB cat. T2010S) following manufacturer’s manual with on-column DNase I digestion ...
-
bioRxiv - Genomics 2024Quote: ... rRNA was depleted using the NEBNext® rRNA Depletion Kit (Bacteria) (NEB, MA, US) from 500 ng of total RNA ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmids were assembled using the NEBuilder HiFi DNA Assembly kit (New England BioLabs). The different truncated or point mutants derived from these plasmids were generated by PCR amplification using primers (Supplementary Table 6 ...
-
bioRxiv - Biophysics 2024Quote: ... the mixture was purified using the Monarch PCR and plasmid DNA purification kit (NEB), eluted in 10 mM Tris-HCl pH 8.0 and stored at -20 °C for further experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by NEBNext Ultra II DNA Library Preparation Kit protocol (NEB #E7645L) and analyzed by Agilent 4200 TapeStation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library was prepared using Ultra II Directional RNA Library Prep Kit (NEB, Cat #E7765) for all samples ...
-
bioRxiv - Biophysics 2024Quote: ... WGBS libraries were prepared using the NEBNext Ultra DNA Library Prep Kit (NEB #E7370L) according to manufacturer’s instructions with modifications ...