Labshake search
Citations for New England Biolabs :
3751 - 3800 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the DNA was extracted by using Monarch® Genomic DNA Purification Kit (NEB, T3010S). For the analysis of microdeletions of the targeted exons an Out-Fwd (p1 GCACAGTCAGACCACAGTCACC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using either Monarch Total RNA Miniprep Kit (New England Biolabs) or Direct-zol™ RNA MiniPrep kit (Zymo Research ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7490S and #E7760S) was used to construct sequencing libraries following the manufacturer’s guidelines with one alteration ...
-
A laboratory framework for ongoing optimisation of amplification based genomic surveillance programsbioRxiv - Genomics 2023Quote: ... cDNA was generated for all samples using LunaScript RT SuperMix Kit (New England BioLabs). Sufficient volume was prepared to perform serial dilutions (10−2 to 10 -7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were inserted into this vector using the Gibson Assembly Cloning Kit (New England BioLabs). The final constructs were linearized using the KpnI restriction enzyme (Promega ...
-
bioRxiv - Genetics 2023Quote: ... Cloning was conducted using the NEBuilder HiFi DNA Assembly cloning kit (NEB, no. E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... ChIP libraries were prepared by NEBNext ultra II DNA library preparation kit (NEB E7645L) and sequenced on one lane of a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: Cells were lysed and RNA extracted using the Monarch Total RNA Miniprep Kit (NEB) or RNA cleanup kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: Coupled transcription-translation assays were carried out with the PURExpress kit (New England BioLabs) as described in (Lukasiewicz and Contreras ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA was synthesized using NEB’s HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For generation of transgenic fish ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB, USA) was used to generate the sequencing library ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using NEB Next Ultra DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs), following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Genomics 2023Quote: ... and ligation of NEBNext adaptors (NEBNext Multiplex Oligos for Illumina kit, New England BioLabs). Libraries were digested using the USER enzyme (New England BioLabs) ...
-
bioRxiv - Microbiology 2023Quote: ... Pulldown RNA was ribominus selected using the NEBNext rRNA Depletion Kit v2 (NEB # E7400L) and RNA-Seq libraries were generated using the NEBNext® Ultra II Directional RNA Library Prep Kit (NEB # E7760L) ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA libraries were prepared using NEBNext Ultra II DNA Library Prep Kit (NEB #E7645S), and sequenced by NovaSeq 6000 System.
-
bioRxiv - Biochemistry 2023Quote: ... site-directed mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer manual ...
-
bioRxiv - Genetics 2023Quote: ... and NGS libraries were quantified by qPCR using the NEBNext Library Quant Kit (NEB). Illumina sequencing was performed using the NextSeq platform with automated demultiplexing and adaptor trimming (Illumina).
-
bioRxiv - Cell Biology 2022Quote: Point mutations in hYAP1-1δ were generated with Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions to synthesise phosphomimic mutants by substituting serine with aspartic acid at two residues ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Extraction was performed by MonarchTotal RNA Miniprep kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer extraction to separate RNA molecules shorter and longer than 200 nucleotides in two different fractions ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was converted to cDNA using LunaScript RT SuperMix Kit (NEB, cat. no. E3010) according to manufacturer specifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7770). The quality and concentration of libraries were assessed with Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... the NEBNext Ultra II DNA library prep kit (New England Biolabs, Ipswich, MA, USA) was used according to protocol ...
-
bioRxiv - Genomics 2023Quote: ... Samples were further quantified by qPCR using NEBNext Library Quant Kit for Illumina (NEB) and then pooled equimolarly based on estimated concentrations ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed with Luna Universal One-Step RT-qPCR Kit from NEB on BioRad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Genomics 2023Quote: ... before the library was prepared with the NEBNext RNA Library Prep kit (Biolabs, E7540). Samples were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genetics 2023Quote: Libraries were generated using the NEBNext® rRNA Depletion Kit (NEB, cat no. E6310) and UltraTM II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The VHH specific sequence was amplified using PCR (Phusion High Fidelity PCR kit, NEB) and correct overhangs were incorporated ...
-
bioRxiv - Developmental Biology 2023Quote: ... First-strand cDNA was synthesized using a ProtoScript II cDNA first strand kit (NEB) with 1 μg of total RNA ...
-
bioRxiv - Biochemistry 2023Quote: TgTR N147 was mutated to threonine using the Q5 Site-Directed Mutagenesis Kit (NEB) per the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed using the Q5® Site-directed mutagenesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... MscS mutants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: cDNA libraries were prepared using a NEBNext Ultra II RNA Library Prep Kit (NEB). RNA and cDNA quality and quantity were evaluated by performing a Qubit assay with the TapeStation 4200 system (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: Chosen residues were substituted with alanine using Q5® Site-Directed Mutagenesis Kit (NEB) according to supplier protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... using primers synthesized by IDT and a Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the Monarch® RNA Cleanup Kit (50 μg) (New England Biolabs) according to the adjusted manufacturer’s instructions for the purification of RNA ≥ 15 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... Mutations on eGFP-ATP7B were prepared following Q5 Site-Directed Mutagenesis Kit (NEB #E0554) protocol.
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... IVT products were purified using a Monarch RNA Cleanup Kit (NEB, T2030L, Ipswich, MA) and stored at -80°C.
-
bioRxiv - Systems Biology 2023Quote: ... The tagmentation process was promptly neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). The samples were then eluted in a final volume of 20 μL using the Elution buffer.
-
bioRxiv - Plant Biology 2023Quote: ... desalted using GenepHlow PCR Cleanup Kit (GeneAid) and ligated with T4 DNA ligase (NEB), each step according to manufacturer’s directions ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified gDNA was subsequently processed using the EpiMark 5hmC Analysis kit (NEB, cat# E3317) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Point mutants were generated using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... and fragments then gel-purified using Monarch® Genomic DNA Purification Kit (NEB: #T3010S). The pBAD33 vector was DpnI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the NEB Monarch DNA Cleanup Kit (NEB, T1030) and eluted with 10 µl of elution buffer.