Labshake search
Citations for New England Biolabs :
3601 - 3650 of 6227 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The washed pellet was resuspended in TM2 buffer with 1 mM CaCl2 and 12000 U of MNase (New England Biolabs), incubated at 23°C for 15 minutes and the reactions stopped by addition of 0.5 mM EGTA ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested cells were rinsed with ice-cold PBS and resuspended in lysis buffer with 1% Triton X-100 and 40 U/mL murine (New England Biolabs) for 20 minutes with intermittent tapping on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10ng of purified BbsI linearized UniSAM or BsmBI linearized pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was ligated with 1 μl of diluted annealed gRNA with 0.5 μl of T4 ligase (New England Biolabs, #M0202L) in a total volume of 10 μl ...
-
bioRxiv - Microbiology 2023Quote: Lysates of HEp-2/ι1hUNGs cells mock infected or infected with wild-type HSV-1(F) at an MOI of 10 for 24 h were treated with alkaline phosphatase (CIP) (New England BioLabs) as described previously48.
-
bioRxiv - Biophysics 2023Quote: ... cells were labeled for 30 min at 37° C with 1 µM Surface BG-Alexa546 (impermeable dye; New England Biolabs) for SNAP in extracellular buffer (EX ...
-
bioRxiv - Biophysics 2023Quote: Aliquots of thawed biomolecule samples (single-stranded RNA [ssRNA] ladder [NEB #N0362], 1 kilobase [kb] double-stranded RNA [dsRNA] ladder [NEB #N0363] ...
-
bioRxiv - Cancer Biology 2023Quote: Each pair of top and bottom oligonucleotides were phosphorylated and annealed by incubating 10 µM of each with 1 × T4 DNA ligase buffer (New England Biolabs), 5U T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... (see the sequence map in Figure 1) was subjected to restriction digestion using two restriction enzymes: XbaI and AccI (New England Biolabs (NEB)) in the cutsmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-118 and AA 119-356 were amplified from a mixed-stage N2 cDNA library using Phusion DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 10 mg/mL BSA in distilled water) with 0.75 µL (150 U) micrococcal nuclease enzyme solution (1:10 micrococcal nuclease (NEB, USA) in micrococcal nuclease reaction buffer) ...
-
bioRxiv - Cell Biology 2023Quote: ... To remove RNA secondary structure and anneal the mRNA capture primer 1 μL of tagged random hexamer (100 μM) and 0.5 μL of 10 mM dNTPs (dNTP solution set NEB - N0446S) were added to the sample ...
-
bioRxiv - Biophysics 2023Quote: ... we digested #126-pSC-T7A1reverse-parS with SpeI-HF and BamHI-HF 1 h at 37°C and heat-inactivated for 20 min at 80°C (New England Biolabs). Subsequently we ran the digested fragment on a 1% TAE agarose gel and the desired ∼14 kbp DNA fragment was isolated from an agarose gel using a gel purification kit (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... We added the 5’-phospho group on the synthetic parS fragment by adding a T4 kinase for 30 min at 37°C and heat-inactivated 20 min at 65°C in 1x PNK buffer supplemented with 1 mM ATP (T4 PNK, New England Biolabs). Next ...
-
bioRxiv - Biophysics 2023Quote: ... we mixed the digested constructs and handles in a 1:10 molar ratio and ligated them together using T4 DNA ligase in T4 ligase buffer (New England Biolabs) at 16°C overnight ...
-
bioRxiv - Biophysics 2023Quote: ... and cloned into Sal I-digested GST vector pGEX-6P-1 (Cytiva) by NEBuilder HiFi DNA Assembly cloning (New England BioLabs). To express the GST fusion protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng of Cy5-labeled and biotinylated DNA was incubated with 1 μg of streptavidin (SA, New England Biolabs, #N7021) in 25 μL of binding buffer (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2023Quote: ... and ΔpreNAC (a.a. 1−36+61−140)) were introduced using the Site-Directed Mutagenesis kit (New England Biolabs, MA, USA). The complete sequences of all recombinant protein constructs used in this study are listed in the Supplementary Information (“Protein construction and sequence” section) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Immunology 2023Quote: A-pixels were degraded by incubating the cells in a 50 μl reaction containing 1 U USER enzyme (New England Biolabs) in Wash Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes from the Native Barcoding Expansion 1-12 & 13-24 from ONT were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... And 1 µg of the total RNA was reverse transcribed into cDNA using Luna script RT Supermix (New England Biolabs) as per the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Pathology 2023Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... The fragments were inserted within the EcoRV site of the Tol1-based transgenesis vector pDon122 (Cosmo Bio, CSR-CT-NU-002-1) using the NEBuilder HiFi DNA Assembly System (New England Biolabs). The Tol1-based transgenic construct (5 ng/µL ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Microbiology 2023Quote: ... 50 pmol of each RNA were dephosphorylated by incubation for 1 h at 37°C with 25 U of calf intestine alkaline phosphatase (NEB) in a final volume of 50 µL ...
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lysate obtained from lysis with 1% NP-40 lysis buffer phosphatase inhibitor were mixed with lambda phosphatase (New England Biolabs) and incubated at 30°C for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA oligos targeting ORF45 listed in Table 1 were then annealed and ligated into the vector using T4 DNA ligase (New England Biolabs) and transformed into Escherichia coli XL-1 Blue cells ...
-
bioRxiv - Molecular Biology 2022Quote: Crushed lungs were homogenized using a mechanical homogenizer (Omni International, Waterbury CT) or cultured cells were lysed in 1× lysis buffer (9803S, NEB) (20 mM Tris-HCl buffer (pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: PCR-generated fragments of the CNX1 and CNX2 genomic regions lacking stop codons and including the 1-kbp promoter regions were obtained using Phusion HF DNA polymerase (New England Biolabs), inserted into pENTR-2B ...
-
bioRxiv - Immunology 2022Quote: ... the pools of insert 1 and the pools of insert 2 were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB). The assembled product was bead-purified using Sera-Mag SpeedBeads (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... To do this 2.5 uL of cutsmart buffer was added to 20 uL of purified PCR product and then 1 uL of DpnI (NEB) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... gondii total RNA was ligated to a small RNA oligo (Rumsh, see Table S9) using T4 RNA Ligase 1 (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... before ligation to microsatellite expansion adapters containing an EcoRV restriction site (listed in Supplemental Table 1) using the T4 DNA Ligase Kit (NEB) at a 5:1 ratio overnight at 16°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 1 µL of nuclease P1 (100,000 U/mL) (New England Biolabs, Fig. 2f and Extended Data Fig. 2c,d) were treated with 1.5 of 10× TURBO DNase buffer or nuclease P1 buffer in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pSpy0K6 and p7INT.1 was extracted using the Monarch® HMW DNA Extraction Kit for Tissue (New England Biolabs®) according to the manufacturers protocol for Gram-positive bacteria (low input ...
-
bioRxiv - Microbiology 2024Quote: ... an inverse PCR was performed using R3-p21 and the oligonucleotides ToANV-rectest-For/ToANV-rectest-Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The HIV-1AC-1 mutations were introduced into WT and N74D pNLdE-luc using the Gibson Assembly Cloning kit (New England Biolabs) and primers shown in Table S1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Immunology 2024Quote: ... To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs, NEB) overnight at 55 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was used for standard library preparation using NEBNext PolyA mRNA magnetic isolation module (NEB, E7490). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...