Labshake search
Citations for New England Biolabs :
3401 - 3450 of 6227 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... larvae were euthanized with ice and digested in 100 µL TE buffer with 1 µL ProK (New England Biolabs). They were then genotyped by PCR and Sanger sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... the pCDFDuet-1 vector was linearized via PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs, NEB) with primers listed in Supplementary Table 10 ...
-
bioRxiv - Immunology 2024Quote: ... Reverse transcription was then performed with 0,5-1 μg of RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) and 3′-RACE CDS primer (Clontech) ...
-
bioRxiv - Evolutionary Biology 2024Quote: Conventional PCR was conducted using plasmids of Sfla Or42a3 as backbone (Q5 DNA polymerase, #M0491, NEB; Supplemental File 1). Primers were designed to introduce the point mutations (Supplementary File 1) ...
-
bioRxiv - Genomics 2024Quote: ... the RT product was digested overnight at 37°C with 1 unit of USER Enzyme (New England Biolabs, M5505L) per µg of product ...
-
bioRxiv - Genomics 2024Quote: ... samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8.0, 50 mM NaCl and 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 30 min at 55 °C in the dark ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...
-
bioRxiv - Microbiology 2024Quote: ... Flanking regions of 1 kb on either side of the target gene were PCR amplified using Q5 polymerase (NEB) and cloned into pLGB13 using the NEBuilder HiFi cloning kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 1:200 dilution of the double-stranded gRNA was ligated into BsmBI-digested plasmids using T4 ligase (NEB). One µL of the ligated vector was then transformed into chemically competent XL Gold E ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA from each phosphatase or control reaction was then used to set up two reactions 20 μL reactions containing 1 μg of treated RNA in NEBuffer 3.1 (New England Biolabs) with or without the addition of 1 μL (1U ...
-
bioRxiv - Microbiology 2024Quote: ... and assembled with NEBuilder Hifi DNA assembly master mix at a 2:1 molar ratio (New England Biolabs #E5520S) following manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... the PCR product was digested overnight at 37°C with 1 unit of NheI-HF (New England Biolabs, R3131) per µg of product ...
-
bioRxiv - Genomics 2024Quote: ... We performed PCR reactions using 1 ng of the pooled gRNA library plasmids per reaction with Q5 polymerase (NEB). The correct size band from the PCR product was then gel-purified from a 2% E-gel EX (Life Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were washed three times prior to labeling by incubation in 1 µM BG-Alexa-546 (New England BioLabs) in EX for 20 min at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... GTP was added to a final concentration of 2 mM along with a buffer including magnesium (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH = 7.5; New England Biolabs) into circRNA solution ...
-
bioRxiv - Biophysics 2024Quote: ... 800 μL of 2 M MgCl2 and 1.6 mL 1 M CaCl2 were added to the lysed cells along with 2.5 μL DNase (New England Biolabs) and OmniCleave endonuclease (Biosearch Technology ...
-
bioRxiv - Cell Biology 2024Quote: ... SNAP-tagged GLP-1R was detected with an anti-SNAP tag rabbit polyclonal antibody (1:500; New England Biolabs) followed by goat anti rabbit IgG HRP (1:2,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products and the backbones pLL3.7m-mTurquoise2-SLBP and pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt were cut with MluI-HF (NEB, R3198S), followed by dephosphorylation with rSAP (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 1 μg of total RNA or 18S rRNA was degraded to single nucleotides using Nucleoside Digestion Mix (NEB #M0649), followed by the addition of a 4-fold volume of methanol and precipitation at −20°C for 2 hours to remove proteins ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the primers (YH146 and YH 147, see Supplemental Table 1) and Q5 High-Fidelity DNA Polymerase (NEB, M0491L). The insertion sequences were cloned from pgLAP5-CRYS-ARL13B-bPAC-EGFP plasmid (gift from Dr ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Biochemistry 2024Quote: ... and m7G(5′)ppp(5′)G capped (New England Biolabs) RP51A pre-mRNA substrates were made by in vitro transcription of a linear DNA template with T7 RNA polymerase (Agilent or purified in the laboratory) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2024Quote: ... 3 µL 10x ThermoPol buffer (NEB), 3 µL H2O and Therminator IX (NEB 10 U/µL ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 μL of QuickCIP (NEB). The reaction was incubated at 27°C for 20 minutes followed by inactivation at 80°C for 2 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl of USER (NEB # E7103L) was added for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of XbaI (NEB R0145S) was used to digest 6 μg of the pcDNA3.1-Cas9 vector ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL BsiWI-HF (NEB, R3553), 3 µL MluI-HF (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL MluI-HF (NEB, R3198), and nuclease-free water to 150 µL at 37 °C for 1 hour ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...