Labshake search
Citations for New England Biolabs :
3501 - 3550 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were inserted into this vector using the Gibson Assembly Cloning Kit (New England BioLabs). The final constructs were linearized using the KpnI restriction enzyme (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... the DNA was extracted by using Monarch® Genomic DNA Purification Kit (NEB, T3010S). For the analysis of microdeletions of the targeted exons an Out-Fwd (p1 GCACAGTCAGACCACAGTCACC ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using NEB Next Ultra DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... ∼100 ng of RNA was treated with NEBNext rRNA Depletion Kit (New England Biolabs). RNA-Seq was performed using libraries prepared with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB, E7645S), and sequenced for 50-nt SE reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB), Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB) and ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (E7546S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of IVT mRNA was conducted using the Monarch RNA Cleanup Kit (NEB #T2040L). To confirm IVT mRNA were of the correct lengths ...
-
bioRxiv - Biochemistry 2023Quote: ... or the Monarch RNA Cleanup Kit (500 μg) (New England BioLabs, cat. no. T2050L). Samples were eluted in a nuclease-free duplex annealing buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA targets were purified with Monarch® RNA Cleanup Kit (T2040L, New England BioLabs).
-
A laboratory framework for ongoing optimisation of amplification based genomic surveillance programsbioRxiv - Genomics 2023Quote: ... cDNA was generated for all samples using LunaScript RT SuperMix Kit (New England BioLabs). Sufficient volume was prepared to perform serial dilutions (10−2 to 10 -7 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7490S and #E7760S) was used to construct sequencing libraries following the manufacturer’s guidelines with one alteration ...
-
bioRxiv - Plant Biology 2023Quote: ... The Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Cat # E3005X) and reaction protocol (cycle variations ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using either Monarch Total RNA Miniprep Kit (New England Biolabs) or Direct-zol™ RNA MiniPrep kit (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: MiRNA sequencing libraries were prepared using NEBNext smallRNA library prep kit (NEB, MA, USA). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... Reactions were performed using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L) and a CFX Opus 384 Real-Time PCR System (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with NEBNext Ultra II Directional RNA library prep Kit (NEB#E7760) and NEBNext rRNA Depletion Kit (NEB#E6310 ...
-
bioRxiv - Molecular Biology 2023Quote: ... NGS libraries were pooled and quantified by qPCR using NEBNext Library Quant Kit (NEB). Sequencing was performed with NextSeq high-output kit with 75/150-cycle single-end reads and automated adaptor trimming and demultiplexing (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... and used for library preparation using NEBNext Ultra Library Preparation Kit (New England Biolabs) and sequenced on an Illumina MiSeq (250bp paired-end).
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from cell pellets using the Monarch gDNA Purification Kit (NEB). 2 µg of purified genomic DNA was then bisulfite converted using the EpiTect Bisulfite Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Active site mutant plasmids were assembled using the Q5 Site-Directed Mutagenesis Kit (NEB). Site-directed mutagenesis reactions were transformed into chemically competent NEB5α or DH5α λpir cells and candidate transformants were selected using kanamycin ...
-
bioRxiv - Microbiology 2023Quote: ... NS5A mutations were constructed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs; E0554S). For E ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reverse-transcription (RT) reactions were performed with 2X LunaScript RT SuperMix Kit (NEB) with 5 μL of RNA input (250 ng of RNA total ...
-
bioRxiv - Genomics 2023Quote: Individual libraries were constructed using NEBNext Ultra II Directional Prep Kit for Illumina (NEB #7760 ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion was performed using the NEBNext rRNA Depletion Kit for bacteria (NEB) and directional cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB, USA) was used to generate the sequencing library ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs), following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA libraries were prepared using NEBNext Ultra II DNA Library Prep Kit (NEB #E7645S), and sequenced by NovaSeq 6000 System.
-
bioRxiv - Biochemistry 2023Quote: ... site-directed mutagenesis was performed using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer manual ...
-
bioRxiv - Genetics 2023Quote: ... and NGS libraries were quantified by qPCR using the NEBNext Library Quant Kit (NEB). Illumina sequencing was performed using the NextSeq platform with automated demultiplexing and adaptor trimming (Illumina).
-
bioRxiv - Cell Biology 2022Quote: Point mutations in hYAP1-1δ were generated with Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions to synthesise phosphomimic mutants by substituting serine with aspartic acid at two residues ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Extraction was performed by MonarchTotal RNA Miniprep kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer extraction to separate RNA molecules shorter and longer than 200 nucleotides in two different fractions ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was converted to cDNA using LunaScript RT SuperMix Kit (NEB, cat. no. E3010) according to manufacturer specifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7770). The quality and concentration of libraries were assessed with Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... the NEBNext Ultra II DNA library prep kit (New England Biolabs, Ipswich, MA, USA) was used according to protocol ...
-
bioRxiv - Genomics 2023Quote: ... Samples were further quantified by qPCR using NEBNext Library Quant Kit for Illumina (NEB) and then pooled equimolarly based on estimated concentrations ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed with Luna Universal One-Step RT-qPCR Kit from NEB on BioRad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Genomics 2023Quote: ... before the library was prepared with the NEBNext RNA Library Prep kit (Biolabs, E7540). Samples were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genetics 2023Quote: Libraries were generated using the NEBNext® rRNA Depletion Kit (NEB, cat no. E6310) and UltraTM II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The VHH specific sequence was amplified using PCR (Phusion High Fidelity PCR kit, NEB) and correct overhangs were incorporated ...
-
bioRxiv - Developmental Biology 2023Quote: ... First-strand cDNA was synthesized using a ProtoScript II cDNA first strand kit (NEB) with 1 μg of total RNA ...
-
bioRxiv - Biochemistry 2023Quote: TgTR N147 was mutated to threonine using the Q5 Site-Directed Mutagenesis Kit (NEB) per the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed using the Q5® Site-directed mutagenesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... MscS mutants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).