Labshake search
Citations for New England Biolabs :
3451 - 3500 of 10000+ citations for Rat Heat Shock Protein Beta 2 HSPB2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72 °C for 2 minutes using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). We used 7 cycles for all amplicons ...
-
bioRxiv - Plant Biology 2024Quote: ... To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). The resulting construct was introduced into Hi-II immature embryos by Agrobacterium-mediated transformation ...
-
bioRxiv - Plant Biology 2024Quote: To obtain CRISPR-Cas9 mutant alleles of RELK2 and RELK3 a dual targeting guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... crRNAs were amplified from genomic DNA (primer sequences can be found in (Supp. Table 2) using Q5 2x Master Mix (NEB) in 100 μL reactions with the following thermal cycling parameters:
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The addition of an NLS or DST to level 1 and level 2 integrase constructs was performed using PCR-mediated site-directed mutagenesis (NEB Q5 Site-Directed Mutagenesis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.2 μl 50x oligos of the AarI recognition site for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher/NEB) for Level 1 cloning ...
-
bioRxiv - Plant Biology 2020Quote: ... mRNA was isolated with Oligo-dT Beads from NEB and RNAseq libraries were constructed with the Directional Kit from NEB. Sequencing was performed at IPS2 Paris ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The reaction was set up using a commercial kit (PURExpress NEB) according to user guidelines ...
-
bioRxiv - Cancer Biology 2021Quote: ... The NEBNext ultra II RNA library prep kit (New England Biolabs) was used to generate poly(A)+ libraries ...
-
bioRxiv - Microbiology 2020Quote: ... the overhanging ends were blunted using a blunting enzyme kit (NEB) and an A-tail was added with Taq DNA polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs). Allelic replacement of the hlyA open reading frame by this constructs ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mutagenic primers and the Q5 site-directed mutagenesis kit (NEB E0554S) were used to generate the BD-Chinmonon-stop and the CG11180/Chigno-sim* mutant ...
-
bioRxiv - Cell Biology 2019Quote: ... The NEBNext Ultra II RNA Library Prep Kit (New England Biolabs) was used to generate TruSeq-barcoded RNA-Seq libraries ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs) and the online tool NEBasechanger to design the mutagenesis primers ...
-
bioRxiv - Microbiology 2020Quote: ... The ChiZ overexpression construct was engineered using the NEBuilder kit (NEB), according to the manufacturer’s instructions with primers PA311 + PA312 and LW043 + LW044 and the pBRplac-lacI derivative ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA fragment ends were repaired using Quick Blunting™ kit (NEB), purified with QIAquick column (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ChIP-seq libraries were made following the NEBnext UltraII kit (NEB) and associated protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were prepared using the E7765L mRNA kit (NEB next). Paired-end read sequencing was performed using the HiSeq2500 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Assembly was done using NEB HiFI DNA assembly kit (NEB E5520) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Ribosomal RNA was depleted using the NEBNext rRNA depletion kit (NEB) following the product instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... MeRIP was performed using the EpiMark N6-methyladenosine Enrichment Kit (NEB) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... ARF1 point mutations were generated by Quick-change Mutagenesis kit (NEB) and KLD reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... and treated with the NEBNext rRNA depletion kit (New England Biolabs) to deplete the ribosomal RNA (rRNAs) ...
-
bioRxiv - Microbiology 2020Quote: ... For 3’ adaptor ligation the NEBNext Small RNA Kit (E7560S, NEB) was used ...
-
bioRxiv - Immunology 2021Quote: ... The adaptors from the NEBNext Multiplex Oligos Kits (NEB, Ipswich, MA) were ligated to the adenylated 3’ ends of the DNA fragments ...
-
bioRxiv - Genomics 2020Quote: ... A quick Ligation Kit (New England Biolabs Inc., MA, CA#M200l) was used for ligating the insert and vector ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA synthesis was performed using the (AMV cDNA kit, NEB, E6550S) according to the manufacturer’s protocol using random primers and 0.1-3 µg of total RNA per sample according to the experiment ...
-
bioRxiv - Microbiology 2019Quote: ... and Monarch Total RNA Miniprep Kit (New England Biolabs, Ipswich, MA) following the supplier protocols ...
-
bioRxiv - Biochemistry 2020Quote: ... then RNAs were purified using a Monarch RNA Cleanup kit (NEB), or homemade equivalent buffers and regenerated columns,75 following the same rationale ...
-
bioRxiv - Developmental Biology 2019Quote: ... Library preparation (New England Biolabs Nest Ultra RNA library prep Kit) and single read Next generation sequencing (Illumina HiSeq 2500 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and one round of rRNA depletion (NEBNext rRNA depletion kit, NEB). After ethanol precipitation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and dual indexing from the NEBNext Multiplex Oligos kit (NEB #7600) following manufacturer protocol including beads size selection for 200 bp inserts ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). The YF-Cav1s effector was produced by subcloning the sequence coding aa 61–178 of human caveolin 1 (UniprotKB-Q03135 ...
-
bioRxiv - Microbiology 2019Quote: ... and Monarch® Plasmid miniprep Kit (New England BioLabs, Ipswitch, MA) was used for purification of plasmid for gene expression and construction of deletion mutant ...
-
bioRxiv - Biochemistry 2019Quote: In vitro translation (IVT) reactions used the PURExpress Δribosome kit (NEB) and a nanoluciferase reporter plasmid (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... mRNA was purified using NEB Monarch RNA cleanup kit (NEB, USA). 3 nl of 40 pg mRNA of each arm of the FusX mitoTALE-BE (left-pT3-FusXTBE-N and right-pT3-FusXTBE-C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, #E7770) following manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... DNA was purified using Monarch® PCR & DNA Cleanup Kit (NEB), using the following recommended protocol modification ...
-
bioRxiv - Cell Biology 2021Quote: ... Suitable NEXTflex-6 barcodes were ligated using Quick Ligation kit (NEB) before consecutive selection of DNA fragments >100 bp and then >150-200 bp using AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... which was performed using Q5 Site-Directed Mutagenesis Kit (NEB, USA) with mutagenesis primers listed in Supplementary Table 2 ...