Labshake search
Citations for New England Biolabs :
3401 - 3450 of 10000+ citations for Rat Heat Shock Protein Beta 2 HSPB2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...
-
bioRxiv - Genomics 2023Quote: ... followed by the addition of 22 µL of ligation mix (20 µL quick ligase buffer and 2 µL of quick ligase, NEB) and incubation at 25°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Unbound material was removed by washing the samples 5x for 5min with head over head rotation at 4°C in wash buffer plus detergent (1x buffer XT, 1% digitonin, 2 mM PMSF and 10% glycerol) using a magnetic separator (New England Biolabs). Bound material was finally eluted with Biotin elution buffer (1x buffer Biotin XT elution ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was isolated from total RNA or crude cell lysates by 2 rounds of affinity chromatography using oligo d(T)25-derivatized magnetic beads (NEB). RNA yields were quantified by ultraviolet (UV ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Biophysics 2023Quote: ... primers with overlapping sequences (Supplementary Tables 1 and 2) were designed to generate point mutations with the NEBuilder HiFi DNA Assembly mix (New England Biolabs). Wild-type protein expression was performed in OverExpress C41 (DE3 ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 mg of small RNA from the 12 diverse organs/tissues was resuspended in 10 mL of 1x GlycoBuffer 2 (NEB) and 7.5 mL PNGaseF (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... They were inserted into the linearized vector of pRVΔG-4mCherry from step 2 described above using HiFi DNA Assembly (NEB, USA). The HiFi reaction was mixed as described below:
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with DNase I (20 units) in the presence of RNase inhibitor at 300 U/ml in x1 buffer # 2 (NEB) at 37°C for 30 min ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA (2 μl) was used as template in 50 μl PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNA amplicons were generated by PCR of 2 ug genomic DNA per 100 ul reaction with Q5 2X Hot Start Master Mix (M0494L, NEB) and enough reactions to maintain 1000x screening sgRNA representation ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell pellets were lysed directly in 8X the cell pellet volume with 2% SDS blue loading buffer (New England Biolabs), containing DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Immunology 2023Quote: ... Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS: E6440S, NEB). After demultiplexing these samples ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Genomics 2024Quote: ... crRNAs were amplified from genomic DNA (primer sequences can be found in (Supp. Table 2) using Q5 2x Master Mix (NEB) in 100 μL reactions with the following thermal cycling parameters:
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72 °C for 2 minutes using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). We used 7 cycles for all amplicons ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Plant Biology 2024Quote: ... To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). The resulting construct was introduced into Hi-II immature embryos by Agrobacterium-mediated transformation ...
-
bioRxiv - Plant Biology 2024Quote: To obtain CRISPR-Cas9 mutant alleles of RELK2 and RELK3 a dual targeting guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB). To obtain CRISPR-Cas9 mutant alleles of RELK1 one guide RNA specific for exon 2 was cloned into pBUE411 by HiFi cloning (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Molecular Biology 2024Quote: ... The ends of DNA were repaired by incubating in 70 μL of 1X NEBuffer 2 containing 0.6 units of T4 DNA polymerase (NEB, M0203S), 2 units of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and Set 2) (NEB, E7335S and E7500S). Paired end sequencing was performed (S1 and S2 ...