Labshake search
Citations for New England Biolabs :
301 - 350 of 628 citations for SARS Coronavirus Spike Glycoprotein S1 His Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The tags were removed using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) to generate wild-type ...
-
bioRxiv - Biophysics 2021Quote: ... was generated by subcloning Mdn1 aa4381-4717 into pSNAP-tag(T7)-2 (NEB N9181S) downstream of the SNAP tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant proteins were affinity purified through GST tag binding to amylose resin (BioLabs) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... The chemical substrates were SNAP- tag ligands (SNAP surface 549 - BG 549 [NEB, S9112S]) and CLIP-tag ligands (CLIP surface 647 - BC 647 [NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Rabbit polyclonal anti-SNAP-tag (Cat no. P9310S, New England Biolabs, 1:1000 dilution). Secondary antibodies used were ...
-
bioRxiv - Immunology 2022Quote: ... To digest remaining M1 tag forward oligo: 3 µl 20U/ µl Exonuclease I (NEB) was added and samples were incubated for 1 h at 37°C ExoI denaturation was performed for 5 min at 98°C ...
-
bioRxiv - Cell Biology 2023Quote: ... To amplify the SNAP tag sequence out of the pSNAPf plasmid (New England Biolabs), the following primers were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... CUT&Tag libraries were prepared with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and indexed primers (Buenrostro et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four exons and three introns of Mlst8 were PCR amplified with primers listed in Table S1 and then cloned into the pCAG backbone using the Gibson Assembly Master Mix (NEB, #E2611S). Similarly ...
-
bioRxiv - Cancer Biology 2020Quote: ... The guide RNA or scrambled control sequences (Supplementary Table S1) were subcloned into the lentiCRISPR v2 using the BsmBI restriction endonuclease (NEB R0580S). Virus was produced through PEI (MilliporeSigma ...
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... A 2.3 kb amplicon including the NAC18.1 gene and ∼800 bp of upstream sequence was amplified by PCR using primers NAC18F2 and NAC18R2 (Table S1) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB). PCR product size and purity was confirmed by agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2022Quote: ... UPF2L (120-1227) were produced by PCR amplification (primers listed in Supplementary Table S1) using the Phusion High-Fidelity PCR kit (NEB #E0553S) prior to restriction digest and ligation into pPROEX-HTB (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then ligated into the Bbs1 site of the vectors pX335 and pKN7 (Appendix Tables S1) in the presence of T4 DNA ligase (New England Biolabs, M202), as previously described (Pyzocha et al ...
-
bioRxiv - Microbiology 2019Quote: ... Primers 5’Pcrz1 and 3’Tcrz1 (Additional file 1:Table S1) were used to amplify the deletion cassette from the yeast genome using Phusion® High-Fidelity Polymerase (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The P562del and Exo+THR mutants were generated on the pET23-P2-D12A-THR (Table S1) background through inverse Polymerase Chain Reactions (iPCR) using Q5® High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions in 25 μl reactions with primers p2_thumb_loop_R/DEL1 (Table S2 ...
-
Enhancers display constrained sequence flexibility and context-specific modulation of motif functionbioRxiv - Genomics 2022Quote: ... Drosophila library fragments were amplified (primers see Supplementary Table S1) and cloned into Drosophila STARR-seq vectors containing the DSCP core-promoters using Gibson cloning (New England BioLabs; E2611S). The oligo library for human STARR-seq screens was amplified (primers see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: Point mutations were introduced through linearizing the plasmid by PCR with primers containing the intended mutations (Supp. Table S1) followed by reverting to circular plasmid with Gibson Assembly Master Mix (M5510A, NEB, USA).
-
bioRxiv - Microbiology 2023Quote: ... custom adapters (Table S1) were ligated using a NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, E6040S), and the transposon-genome junction was amplified with primers (Table S1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA libraries from at least three replicate individuals per sex for each lineage (Table S1) were prepared from gametes using NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs). Mature gametophytes release gametes just after the medium renewal ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). The enzymes mentioned were purchased from New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: C-terminally (His)6-tagged LukE was expressed in BL21 (DE3) Escherichia coli cells (NEB). Transformed cells were grown at 37 °C in Terrific broth supplemented with 100 μg/mL ampicillin to a density of OD600 = 0.6 ...
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... The D614G spike plasmid was generated by introducing the mutation into the Wuhan reference strain via Q5 site-directed mutagenesis (NEB). The T95I ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations were introduced into the phCMV-Spike plasmids using the mutagenic primers and the Q5 site directed mutagenesis kit (NEB). In addition ...
-
bioRxiv - Biochemistry 2020Quote: ... was replaced with sequence for a 3×FLAG tag by Gibson Assembly (New England Biolabs) to create payload plasmid pSAB41 ...
-
bioRxiv - Immunology 2022Quote: ... periplasmic expression vectors with C-terminal HA-His6 tags using Gibson cloning (New England Biolabs). Nanobodies were produced in Escherichia coli WK6 transformed with the respective expression vectors ...
-
bioRxiv - Cell Biology 2019Quote: ... Fusions to the human O6-Alkyl-DNA transferase (SNAP-tag, New England Biolabs, Beverly, MA) were expressed from plasmid pAGT-Xpress ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with SNAP-tag ligand SNAP-Cell 647-SiR (New England BioLabs; S9102S) at a final concentration of 100 nM for 15 minutes followed by 30-45 minute washout in i3Neuron Maintenance Media before imaging in i3Neuron Imaging Media ...
-
bioRxiv - Plant Biology 2023Quote: AtPAXX fused to a hexahistidine tag (pHAT4-atpaxx) was expressed in BL21(DE3) cells (NEB). The proteins were purified using Ni-NTA (Qiagen) ...
-
bioRxiv - Biophysics 2023Quote: ... and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... Biotinylated oligo tags were amplified on-bead using 2X Q5 Hot-Start Mastermix (NEB #M0494) with primers that add the indexed full Illumina adaptor sequences.
-
bioRxiv - Cell Biology 2023Quote: ... and an internal ribosomal entry site driven SNAP-tag (N9181S, New England BioLabs, Ipswich, MA), respectively ...
-
bioRxiv - Biochemistry 2024Quote: Constructs bearing a C-terminal cMyc tag were cloned by site-directed mutagenesis (NEB, M0554S) using oligonucleotides as primers bearing a 5’-overhang encoding the inserted sequence ...
-
bioRxiv - Physiology 2019Quote: ... gene-specific oligonucleotides targeting this region (see Table S1) were designed to amplify this predicted partial fragment using Q5 High Fidelity DNA Polymerase (New England Biolabs, Whitby, On) with whole adult female A ...
-
bioRxiv - Developmental Biology 2022Quote: ... the PCR products (primers shown in Table S1) were digested with AvaII and HpyCH4IV restriction enzymes (New England BioLabs; Ipswich, MA, USA), respectively ...
-
bioRxiv - Pathology 2020Quote: ... Candidate colonies were screened using external primers (Table S1) by PCR using Phusion HiFi polymerase according to the manufacturer’s instructions (New England BioLabs, Ipswich, MA, USA). Candidates with the expected PCR fragment size were sequenced using external primers to confirm the knock-out of the gene fragment.
-
bioRxiv - Synthetic Biology 2023Quote: ... The pUdO#a was obtained by assembling four fragments (Table 1 and Figure S1) using the Gibson Assembly® Master Mix (New England Biolabs, E2611) according to the supplier’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... employing triple template PCR as described128 with primer sequences listed in Supplementary Table S1 using the Q5 polymerase (New England Biolabs, Ipswich, USA). The knockout constructs were released from their vector backbones with XhoI (PpAARE1) ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting upstream and downstream amplicons were fused by PCR with the primers listed in Table S1 and the fused PCR product was purified and digested with the HindIII restriction enzyme (New England BioLabs, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Immunology 2022Quote: ... The spike plasmids were linearized by restriction enzymes and transcribed to mRNA by in vitro T7 RNA polymerase (NEB, Cat # E2060S) as previously described7,8.
-
bioRxiv - Immunology 2021Quote: ... The D614G Spike was generated by introducing the corresponding mutation in the Wuhan reference strain using Q5® Site-Directed Mutagenesis Kit (NEB).