Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using the Q5 High-Fidelity DNA Polymerase Kit (NEB) and primers specific for the microsatellite expansion adapters (1X Q5 Reaction Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using Monarch PCR/DNA Cleanup Kit (New England BioLabs). ChIP-seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Genetics 2023Quote: ... Small RNA libraries were purified with the Monarch PCR Cleanup Kit (NEB) prior to size selection to obtain the correct fragment sizes for small RNA analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR templates for the dsRNA were prepared using T7 megascript Kit (NEB). dsRNA against bacterial β-galactosidase gene (lacZ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... each with 12-cycles (Phusion High Fidelity PCR kit, New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... The inactivated reactions were purified with the Monarch PCR purification kit (NEB).
-
bioRxiv - Synthetic Biology 2024Quote: ... and purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs). Gel fragments were extracted using GeneJet Gel extraction kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA reactions were purified using the Monarch PCR Purification Kit (NEB #T1030L) and eluted in 10µl elution buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... products were purified with the Monarch PCR DNA cleanup kit (NEB, Inc.) and analyzed by endpoint PCR ...
-
bioRxiv - Microbiology 2023Quote: ... purification (Monarch PCR & DNA Cleanup Kit, New England Biolabs Cat. No. T1030), and ligation with T4 DNA ligase (New England Biolabs Cat ...
-
bioRxiv - Microbiology 2023Quote: ... The enzyme was removed with the Monarch PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... PCR and Gibson Assembly® Cloning Kit (New England Biolabs, Ipswich, MA). The product was transformed in E ...
-
bioRxiv - Microbiology 2024Quote: ... PCR-amplified DNA fragments were assembled by Gibson assembly kit (NEBuilder, NEB) as per manufacturer’s protocol and introduced into DH5α E ...
-
bioRxiv - Cell Biology 2024Quote: Monarch® PCR & DNA Cleanup Kit (New England Biolabs, cat. no. T1030S)
-
bioRxiv - Microbiology 2024Quote: ... Digested products were cleaned using Monarch® PCR & DNA Cleanup Kit (NEB) and incubated with T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genotyping of the embryos was performed from the fin clip biopsies with Q5® High-Fidelity DNA Polymerase (New England Biolabs) as stated above ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Biochemistry 2022Quote: ... UPF2L (120-1227) were produced by PCR amplification (primers listed in Supplementary Table S1) using the Phusion High-Fidelity PCR kit (NEB #E0553S) prior to restriction digest and ligation into pPROEX-HTB (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... The remaining DNA was used to amplify fragments of the target site by PCR and amplicons were purified using the Monarch® PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions and either sent for 250 bp paired end Illumina amplicon sequencing (Genewiz) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Fusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Molecular Biology 2022Quote: ... Two to three PCR reactions per sample were combined and cleaned-up using the Monarch PCR and DNA clean-up kit (NEB, T1030S). 10-100 ng of DNA from each sample was carried forward for end-repair using the NEBNext Ultra II End repair/dA-tailing Module (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear plasmid fragments were generated by PCR and purified by Monarch® PCR and DNA cleanup kit (New England BioLabs®). Ligations were performed with In-Fusion® enzyme at 50°C for 15 minutes (min ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Custom Nextera PCR primer and the NEBNext High-Fidelity 2x PCR Master Mix (Nextera DNA Library Preparation Kit (New England BioLabs, E7530L) and purified with the Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification of cDNAs was performed using a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo, Japan) and resulting PCR products were cloned using NEB® PCR Cloning kit (New England BioLabs). Positive clones and plasmids were verified by DNA sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S, T1030S).
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmid (Monarch® PCR mini-prep kit) and gel extraction kits (Monarch® DNA gel extraction kit) were also obtained from NEB and used according to the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Immunology 2021Quote: ... The released DNA was cleaned up using Monarch DNA PCR Clean Kit (NEB) and eluted in TE buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon was purified using the Monarch PCR and DNA Cleanup Kit (NEB), and 1 ug used as template for transcription of digoxigenin labelled riboprobes using the DIG RNA Labelling mix (Sigma).
-
bioRxiv - Molecular Biology 2021Quote: ... The next day samples were purified using PCR cleanup kit columns (Monarch, NEB) and eluted using 50 μl kit elution buffer.
-
bioRxiv - Genomics 2022Quote: ... DNA was purified using a Monarch PCR & DNA Clean up kit (NEB, T1030) and eluted in 12 μL of water.
-
bioRxiv - Microbiology 2020Quote: ... the source plasmid (p-retronWT) was mutagenized through PCR using a kit (NEB; Q5-Site-Directed Mutagenesis Kit ...
-
bioRxiv - Synthetic Biology 2019Quote: ... For cloning purposes DNA was purified using Monarch PCR & DNA Cleanup Kit (NEB) and assembled using NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplicons were purified using the Monarch DNA Gel Extraction Kit (NEB, T1020S) and subjected to sequencing.
-
bioRxiv - Genetics 2020Quote: ... samples were purified by the Monarch PCR & DNA Cleanup Kit (New England Biolabs). For the library preparation ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified and in vitro transcribed using T7 HiScribe kit (NEB). Transcribed RNA products were run on a 5% acrylamide TBE-urea gel and visualized with 0.02% methylene blue in 1x TBE ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction was purified using the Monarch PCR and DNA cleanup kit (NEB) to remove unincorporated dATP ...
-
bioRxiv - Molecular Biology 2022Quote: ... agarose gel and PCR clean ups were performed using Monarch DNA kits (NEB). Plasmid DNA constructs were confirmed by sequencing on the ABI 3130xl capillary machine (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified using Monarch DNA Gel Extraction Kit (New England Biolabs). Both the vector and the complete insert were digested by BsmBI (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified using Monarch DNA Gel Extraction Kit (New England Biolabs). Both the vector and the complete insert were digested by BsmBI (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products recombined using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All constructs were verified by sequencing.
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... PCR fragments were purified using Monarch DNA Gel Extraction Kit (New England Biolabs), and were digested with EcoRI and BamHI (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR fragments were then purified using a gel extraction kit (New England Biolabs) and subjected to sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were then concentrated on columns (Monarch PCR & DNA Cleanup Kit, NEB). The size of the DNA fragments generated (150-400 bp ...