Labshake search
Citations for New England Biolabs :
301 - 350 of 1294 citations for Mayaro Virus E2 Envelope Protein Mouse Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified from afp18-3CTS with primers including a stop codon before the tag and closing the linear fragment using the KLD enzyme mix from New England Biolabs (NEB). Positive clones were confirmed with colony PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Biochemistry 2024Quote: ... C-terminal mEGFP-tag and HSP18 terminator for assembly into pICSL86955 using BsaI (ThermoScientific) restriction enzyme and T4 DNA ligase (New England Biolabs). The GoldenGate restriction-ligation-reaction was transformed into E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Lambda Protein Phosphatase (NEB) assay was performed as described by the supplier ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 protein (NEB M0641S) and phenol red injection dye ...
-
bioRxiv - Developmental Biology 2021Quote: Cas9 protein (M0646, NEB) and sgRNAs against antisense of exons 14 ...
-
bioRxiv - Plant Biology 2021Quote: Purified LPR1 protein was analyzed using Protein Deglycosylation Mix II (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein (200 µg) was precleared with protein G magnetic beads (New England Biolabs) and incubated overnight (4° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved G protein was dephosphorylated by lambda protein phosphatase (NEB, Frankfurt, Germany), calf intestinal phosphatase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The protein ladder used was Colour Protein Standard Broad Range (NEB, Ipswich, US).
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by PCR and subcloned into pMRX-IP backbone vector together with the EGFP tag by Gibson Assembly (New England Biolabs, E2611L). All deletion and point mutation mutants of LC3B and GABARAP were generated by a PCR-based method.
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... A V5 tag was inserted before the stop codon by Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). Afterwards ...
-
bioRxiv - Bioengineering 2020Quote: ... and cloned into pET vector in frame with a C-terminal 6XHis tag by Gibson assembly (NEBuilder® HiFi DNA Assembly Master Mix, New England Biolabs). DNA encoding SARS-CoV-2 S RBD (S a.a ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Integration of the amplified mouse genomic DNA into the donor plasmid and integration of the 3x HA tag before the stop codon were each carried out by Gibson assembly (NEB, USA). HDR into C57BL/6J background mouse embryos was carried out by mixing the plasmid donor ...
-
bioRxiv - Biophysics 2023Quote: ... PUS1D134A lacking the N-terminal HIS-tag was subcloned into expression vector pET21d (EMD Biosciences) using a Gibson Assembly cloning kit and protocol (NEB # E5510S) and sequence verified ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... purified proteins were directly digested by O-glycosidase (P0733, NEB, 4,000 units/µg protein) and α2-3 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were also treated with Lambda Protein Phosphatase (Lambda PP, New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... an RNA-protein complex was formed with 1 µM Cas9 protein (New England Biolabs) and 1 µM gRNA pool (3 gRNAs in total ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 15µl to 25µl of extracted proteins in NuPAGE buffer and 0.5µl protein ladder (BioLabs) were loaded into a Bio-Rad 4-15% Mini-PROTEAN precast polyacrylamide gel ...
-
bioRxiv - Immunology 2021Quote: ... IDEZ was used to cleave the Fab (in the supernatant) from the Fc (remained on the magnetic beads) (New England Biolabs) for 1 h at 37°C and collected ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lambda protein phosphatase (λPP) (NEB) was used to dephosphorylate the purified chromatin ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.9nM Cas9 protein (NEB M0386T) and 14% Phenol Red ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein (20 µM, NEB) was mixed in a 1:1 ratio with the gRNA complex and incubated for 5-10 minutes at room temperate to produce the Cas9:gRNA RNP complex at a final concentration of 10 µM ...
-
bioRxiv - Biochemistry 2022Quote: ... Lambda protein phosphatase (P0753, NEB), AZD8055 (S1555 ...
-
bioRxiv - Immunology 2022Quote: ... Protein G magnetic beads (NEB) were incubated with anti-2A (Novus ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Cas9 protein (NEB M0386T) into the yolk of 1-cell stage embryos in a volume of 1nl ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Cas9 protein (NEB, M0646), and 200 ng/ul of guide RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Protein Kinase K (NEB) and incubated at 37 °C for 1 h ...
-
bioRxiv - Physiology 2023Quote: ... Cas9 protein (New England Biolabs) and PAGE purified ssHDR template (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cas9 protein (NEB, Ipswich, MA), and ssODN (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... coli Protein Synthesis System (NEB) [48] at 2 x the reaction scale ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein Deglycosylation Mix II (NEB) was added and further incubated for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Genomics 2019Quote: ... were used to PCR amplify both wild type and RRM3 Mt cDNA inserts for ligation into a pET28b vector containing an N-terminal 10xHis-SUMO tag using the Quick Ligation kit (NEB, Ipswich, MA). Plasmids containing the cDNA of interest were verified by Sanger sequencing prior to expression (Quintara Biosciences ...
-
bioRxiv - Cell Biology 2019Quote: ... with the mCherry tag from the pET28 mCherry plasmid using NEB Gibson Assembly (Gibson Assembly Master Mix, New England BioLabs, Cat. # E2611S). See Table EV10 for primer sequences.