Labshake search
Citations for New England Biolabs :
301 - 350 of 1359 citations for F actin uncapping protein LRRC16A CARMIL1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Point mutations (K66E and K166A) on F-BAR-EGFP were produced by the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). Identity of plasmids was confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Immunology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H218O (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by extending a common sgRNA(F+E) sequence with gene-specific crRNA sequence downstream of a T7 promoter by PCR with Phusion polymerase (NEB). PCR product was gel extracted and sgRNA was in vitro transcribed using the MegaShortScript™ T7 Transcription Kit (Invitrogen AM1354 ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Plant Biology 2022Quote: ... then ligating them into the pGGA-F GreenGate vectors or into the Golden Gate-ready pMiniT™2.0 (NEB #E1203S). Sequences containing BsaI cut sites (such as AtRDR1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: Lysates of HEp-2/ι1hUNGs cells mock infected or infected with wild-type HSV-1(F) at an MOI of 10 for 24 h were treated with alkaline phosphatase (CIP) (New England BioLabs) as described previously48.
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Cell Biology 2024Quote: ... StrepII-EPLINα WT plasmid was created by inserting the EPLINα PCR product (created with EPLINα Strep F/R primers) into pcDNA3 StrepII MCS vector cleaved with EcoRI/AgeI using NEBuilder HiFi DNA Assembly (NEB). The deletion mutants (ΔNHX ...
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Molecular Biology 2024Quote: ... the purified HIV-1C T/F LTR PCR products and C731CC were digested with EcoRI and BssHII (New England Biolabs). The restriction fragments of the C731CC lentiviral vector were analyzed on the 1% agarose gel and the bigger band fragment containing the linearized C731CC lentiviral vector was extracted using the GeneJet Gel Extraction Kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... where samples were heat-shocked for 5 minutes at 95°C to inactivate proteases before they were incubated with 500 units of PNGase F (New England Biolabs) for 4 hours at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... then 30 μl denatured lysate were treated with 2 μl Endo H or 1 μl PNGase F enzymes (New England Biolabs) in 40 μl reactions according to the manufacturer instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... purified proteins were directly digested by O-glycosidase (P0733, NEB, 4,000 units/µg protein) and α2-3 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were also treated with Lambda Protein Phosphatase (Lambda PP, New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 15µl to 25µl of extracted proteins in NuPAGE buffer and 0.5µl protein ladder (BioLabs) were loaded into a Bio-Rad 4-15% Mini-PROTEAN precast polyacrylamide gel ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lambda protein phosphatase (λPP) (NEB) was used to dephosphorylate the purified chromatin ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.9nM Cas9 protein (NEB M0386T) and 14% Phenol Red ...
-
bioRxiv - Biochemistry 2022Quote: ... Lambda protein phosphatase (P0753, NEB), AZD8055 (S1555 ...
-
bioRxiv - Immunology 2022Quote: ... Protein G magnetic beads (NEB) were incubated with anti-2A (Novus ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Cas9 protein (NEB, M0646), and 200 ng/ul of guide RNA ...
-
bioRxiv - Bioengineering 2024Quote: ... coli Protein Synthesis System (NEB) [48] at 2 x the reaction scale ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein Deglycosylation Mix II (NEB) was added and further incubated for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Protein Kinase K (NEB) and incubated at 37 °C for 1 h ...
-
bioRxiv - Physiology 2023Quote: ... Cas9 protein (New England Biolabs) and PAGE purified ssHDR template (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cas9 protein (NEB, Ipswich, MA), and ssODN (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2024Quote: Protein was expressed from NEB BL21(DE3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The dried glycoproteins were incubated with trypsin for 16 h at 37°C before releasing N-glycans using PNGase F (New England Biolabs, MA). Liberated N-glycans were separated from glycopeptides by C18 Sep Pak SPE cartridges (Waters Corporation ...
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 μg protein were denatured as above and adjusted to a final concentration of 1x Glycobuffer 2 containing 125U PNGase F per μg (NEB, P0704S) in 50 μl ...
-
bioRxiv - Cancer Biology 2022Quote: In vitro transcription of LINC00313 or firefly luciferase (F-luc) mRNA was performed using the HiScribe™ T7 High Yield RNA Synthesis kit (New England Biolabs), according to the instructions by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: Proteins were reduced with 25 mM DTT and then alkylated with 40 mM iodacetamide prior to the addition of PNGase F at a final concentration of 1500 U (New England Biolabs, P0704) to achieve the removal of N-glycosylations ...
-
bioRxiv - Biochemistry 2022Quote: ... the sample was diluted to 50 μL with ammonium bicarbonate buffer and incubated at 37 °C with 2 μL of PNGase F (New England Biolabs P0705S) diluted 1:100 in ammonium bicarbonate for an additional 7 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Genetics 2024Quote: ... 400 nM of each of the flanking primers PS1057-NGS-F and PS1057-NGS-R (S2 File) and 0.1 units/µl of LongAmp Taq DNA polymerase (NEB Cat. # M0323L). In a second amplification step ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... Whole-cell extracts were quantified using the BCA assay and 10 µg was subjected to PNGase F (New England Biolabs, #P0705S) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and then 5 μL of 10% NP-40 and 10X GlycoBuffer 2 as well as 1 μL of PNGase F (New England Biolabs #P0704S) were added to make a final reaction volume of 50 μL ...