Labshake search
Citations for New England Biolabs :
301 - 350 of 6087 citations for 6 1 4 dioxa 8 azaspiro 4.5 decan 8 yl 3 hydroxy 2 iminopyrimidin 4 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and 4 μL T4 polynucleotide kinase (New England BioLabs) in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/µl Taq DNA ligase (M0208S, NEB)).
-
bioRxiv - Molecular Biology 2022Quote: ... including 2.5-4 min fragmentation at 94⁰C (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... 4 U/μl T7 RNA polymerase (NEB - pH 7.9) in a total volume of 150 µl ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 μL T4 DNA ligase buffer (New England Biolabs), 1 μL H2O ...
-
bioRxiv - Genomics 2022Quote: ... 4 U of T7 DNA polymerase (New England Biolabs) were used to perform second-strand synthesis and DNA was purified using CleanPCR beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were mixed with 4 uL T4 buffer (NEB B0202S), 4 uL BbsI-HF (NEB R3539L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518), and 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts were treated with 4 U DNase I (NEB) for 30 min at 37°C and subsequently separated on urea-polyacrylamide (PAA ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4 μL of α2-3,6,8,9 Neuraminidase A (NEB) in 1x NEB Glyco Buffer #1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... micrococcal nuclease (MNase; 4×105 units; New England Biolabs) or RNase A (2 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 4 μL of 10X RNase H buffer (NEB B0297S) and incubating for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of murine RNase inhibitor (New England Biolabs), and 40 μg (HEK293T and U2OS cells ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 μL of t7 polymerase (New England Biolabs #M0251S), 33 μL RNase-Free water ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4 units of Proteinase K (New England Biolabs).
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Biophysics 2024Quote: ... 10 µl of each sample was mixed with 4 µL native loading dye (1% Orange G (NEB) dissolved in 50% glycerol and 50% EMSA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Microbiology 2021Quote: ... together with the Bakt_314F (CCTACGGGNGGCWGCAG) and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: DNA was isolated from single fins by placing them in lysis buffer (10mM Tris pH 8, 100mM NaCl, 10 mM EDTA, 0.5% SDS) with Proteinase K (333µg/mL, NEB P8107S) at 55°C for between four hours and overnight ...
-
bioRxiv - Systems Biology 2020Quote: ... A total of 8 cDNA libraries were prepared with an NEBNext Ultra II RNA Library Prep kit (NEB, cat:E7770S) and sequenced with an Illumina HiSeq4000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl of a mix preheated to 37°C and containing 2.5 U of RNase H (New England Biolabs), 2.5× RNase H reaction buffer (1× buffer ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified by PCR for a total of 8 cycles in 100µL reactions with Phusion polymerase (New England Biolabs). No PAGE purification was performed to ensure that our libraries were not biased against short nascent RNA insertions.
-
bioRxiv - Biochemistry 2023Quote: ... Snap-cooled RNAs were diluted to 8 nM in 2x RNA master mix (0.2 mg/mL bovine serum albumin (molecular biology grade, NEB), 0.2 mg/mL yeast tRNA ...
-
bioRxiv - Genomics 2023Quote: ... ATAC-seq libraries were prepared by ∼8 cycles of PCR using NEBNext High Fidelity 2X PCR Master Mix (NEB) and primers containing Illumina barcodes (Buenrostro et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... an equal amount of DNA (8μg) was treated with 8□l of RNase H in 1x RNase H buffer (NEB) for 5 hours at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Biophysics 2021Quote: ... 4 µL of 0.2 mg/mL of streptavidin (NEB; N7021S) in crystallization buffer were added to the biotinylated lipid surface and incubated for 30 min in a humidity chamber at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... β1-4 galatosidase or α2-3,6,8 Neuraminidase (New England BioLabs) at concentration of 5000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of T4 DNA ligase (40U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 10× T4 RNA ligase buffer (New England Biolabs), 4 μl T4 RNA ligase ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...
-
bioRxiv - Plant Biology 2021Quote: ... The 4 fragments were fused together using NEB builder (NEB). The reaction was amplified by PCR for 30 cycles and transformed into B ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... column-purified and transformed in 4 or 5 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...