Labshake search
Citations for New England Biolabs :
451 - 500 of 6087 citations for 6 1 4 dioxa 8 azaspiro 4.5 decan 8 yl 3 hydroxy 2 iminopyrimidin 4 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Molecular Biology 2023Quote: ... increasing volumes of SPRI beads were mixed with 1 μl of a 4-fold dilution of 100 bp DNA ladder (New England Biolabs) and diluted to a final volume of 100 μl with 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Genomics 2023Quote: ... 30 minutes at 72°C and finally held at 4°C until 1 μl Exonuclease I (20U/μl, catalog num. M0293S, NEB) was added to each sample ...
-
bioRxiv - Microbiology 2023Quote: ... was generated by amplifying 1 kb fragments upstream and downstream of the region (Table 4) and cloned into pKNOCK-bla-erm57 using NEBuilder (NEB). The plasmid was conjugally transferred into B ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysates were incubated for 1 hour at 4 °C on a nutator with 40 µL amylose resin slurry (New England Biolabs) equilibrated with amylose wash buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Plant Biology 2021Quote: ... The final library products were further purified using an 8% polyacrylamide gel to excise 130-160nt products relative to the pBR322 DNA-MspI Digest ladder (New England Biolabs, Cat# E7323AA). The purified libraries were pooled and sequenced (single end 50 bp ...
-
bioRxiv - Microbiology 2019Quote: ... 10 (GSF1697) or 12 (GSF2248) PCR cycles were run using 8-nt barcoded oligos from NEBNext Multiplex Oligos barcode kit (NEB cat# 6609S). The libraries were purified with Agencourt AMPure XP beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... was immersed in a 10-fold volume of digestion solution with 8 U/mL Proteinase K (P8107S, New England Biolabs, Ipswich, USA) in digestion buffer containing 50 mM Tris pH 8.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified for 9 cycles for the hepatocyte libraries and 8 cycles for the liver organoid libraries using Phusion® High-Fidelity PCR Master Mix (NEB, M0531S) with the Nextflex primers ...
-
bioRxiv - Synthetic Biology 2021Quote: ... for 4 hours at 37°C and treated with Antarctic phosphatase (NEB) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Annealed oligos were mixed with 4 μL 6X loading dye (NEB, B7024S), loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1 ...
-
bioRxiv - Genomics 2020Quote: ... the circularized DNA was incubated in 1x NEBuffer 4 reaction buffer (NEB) (50 mM potassium acetate ...
-
bioRxiv - Genomics 2019Quote: ... 4) We used 2.75 µl 10X RNA Fragmentation Buffer (New England Biolabs) in a total 27.5 µl fragmentation reaction volume and later on added 2.75 µl 10x RNA Fragmentation Stop Solution ...
-
bioRxiv - Systems Biology 2020Quote: ... a 4-cycle PCR was performed with OneTaq polymerase (New England Biolabs) in 200 reactions (125 μL/reaction) ...
-
bioRxiv - Microbiology 2021Quote: ... The parental plasmid was digested for 4 h using Dpn1 endonuclease (NEB) at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... a mix of 4 μl First strand Synthesis Reaction Buffer (NEB-kit), 0.5 μl Murine RNase Inhibitor (NEB-kit ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 20 mg/mL RNase A (New England Biolabs #T3018L) is added to the RNase positive aliquot of non-lysed TSB from 1-gram cannabis flower homogenate ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 mM EDTA) + 4 μl of Proteinase K (20 mg/ml, NEB) at 55°C (300 rpm continuous shaking in a thermomixer) ...
-
bioRxiv - Developmental Biology 2021Quote: ... by incubating with DNA polymerase I Klenow (4 mL; New England Biolabs) for 90 min at 37C with rotation ...
-
bioRxiv - Immunology 2022Quote: ... and subsequently incubated with 4 U of alkaline phosphatase (New England Biolabs) at 37°C for 30 min to hydrolyze unreacted NTPs ...
-
bioRxiv - Genetics 2023Quote: ... 4 µl Luna universal qPCR Master Mix (New England Biolabs, Hitchin, UK) and 1.8 µl ultrapure water ...
-
bioRxiv - Biophysics 2024Quote: ... 4 mM BME) and added to an amylose resin (New England Biolabs), incubating overnight at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 47 ml water) and 4 µL 10mg/ml Proteinase K (P8108S, NEB). The samples were incubated for 8 hours at 55 °C followed by 10 min at 98 °C to inactivate the Proteinase K ...
-
bioRxiv - Biochemistry 2024Quote: ... then subsequent addition of 4 units of proteinase K (New England Biolabs) and incubation at 55 °C for 30 min ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... the plasmid pT7/3a coding for 4.5S RNA was linearized using BamHI (NEB) and in vitro transcription was performed as above ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 mL of culture was removed and treated with DNase I (New England Biolabs; 4 µL and 25µL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... another 1 million cells were processed in only DigWash and during Dam activation incubated with 4 units of Dam enzyme (NEB, M0222L). This Dam control sample serves to account for DNA accessibility and amplification biases.
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 mM Tris-Cl pH 7.4, 12 mM MgCl2, 1% NP-40, 0.5 mM DTT, 0.1 mg/ml cycloheximide, 80 U/ml NEB murine RNase inhibitor). Beads were transferred to a fresh tube and immunoprecipitated RNA extracted by incubating beads in buffer RLT (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Microbiology 2024Quote: ... the purified PCR products were ligated with the empty vectors in a molar ratio of 1:4 using T4 DNA ligase (NEB, USA) at 16 °C overnight ...
-
bioRxiv - Genetics 2024Quote: ... of 8 or greater were subjected to Poly-A enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB catalog number E7490). NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (catalog number E7760L) ...
-
bioRxiv - Developmental Biology 2024Quote: ... of 8 or greater were subjected to Poly-A enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB catalog number E7490). NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (catalog number E7760L ...
-
bioRxiv - Genomics 2024Quote: ... and half the elution was used as a template in a second round of 8-10 cycle PCR to prepare Illumina libraries using NEBNext multiplex oligos using the same conditions described above (NEB E7335L and E7500L). The final PCR product was purified using AMPure XP beads (Beckman Coulter A63882 ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...