Labshake search
Citations for New England Biolabs :
3401 - 3450 of 6746 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... PCR work was carried out with primers provided by IDT (Integrated DNA Technologies) (Table 5) and with a proof-reading Q5® High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacture’s guidelines ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Genomics 2020Quote: ... Reverse transcription product was purified using a DNA Clean and Concentrator-5 and used as the template for PCR amplification using i5 and i7 dual indexing primers (NEB #E7600S).
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... and 4.5 μM biotinylated primer oligo IF238 (5/Biosg/TC TCC TCC TTC T) were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75°C for 5 min and cooled to 4°C at a rate of −1°C min−1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 region of the 16S rRNA gene was amplified from approximately 5 ng of extracted DNA in 25μl reactions using Q5 HS High-Fidelity polymerase (New England BioLabs, Ipswich, MA) with inline bare primer design as previously described.51 The following V4-specific primers were used ...
-
bioRxiv - Biochemistry 2022Quote: ... the used RNA was radioactively labelled on the 5’-end with [γ-32P]ATP (10 mCi/ml, Hartmann Analytic) and T4 PNK (NEB), following purification via PAGE ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS) at 60°C with primers (Table S3) radiolabeled at their 5’-end using T4 Polynucleotide Kinase (NEB, Cat# M0201S) and γ-32P ATP according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... The samples were run in a 5% native PAGE gel in an ice bath along with low range ssRNA ladder (New England Biolabs, Inc.). The gels were prepared using Acrylamide ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with the oligonu-cleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit (5 μg) user manual (NEB #T1030). Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Biophysics 2021Quote: ... to obtain a 1080 bp long DNA with 5 bp overhang and was subsequently dephosphorylated with Antarctic phosphatase (NEB, catalog #M0289S). The obtained product was PCR purified using Qiagen PCR purification kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Molecular Biology 2022Quote: pGEMHE plasmid constructs (Supplementary Table 2A) were linearized and 5’-capped mRNA was synthesized with T7 polymerase (NEB HiScribeT7 ARCA kit) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All but 5 µl of this product was then diluted 20x into a PCR reaction that consisted of 1x Taq buffer (NEB, B9014), 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... An RNA adaptor (5’ GACCUUGGCUGUCACUCA-3’) was ligated to the 5’-monophosphate of the RNA end by incubation with T4 RNA ligase (NewEngland BioLabs, Inc.), at 25°c for 16 h ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA bound to Gag was first dephosphorylated at the 5’ end with calf intestinal alkaline phosphatase (New England BioLabs, NEB) followed by T4 polynucleotide kinase-catalyzed (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: DNA oligonucleotides 308 and 310 were 5’-radiolabeled with [γ-32P] ATP (Perkin-Elmer) using T4-polynucleotide kinase (New England Biolabs). Radiolabeled nucleotides were then purified by electrophoresis in a 12% native polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products (donor-5’biotin, donor-unmodified) were gel purified using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) and eluted in 20μl embryo transfer water (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Colony PCRs were carried out in 12.0 μL final volumes containing: 5 μL of high-fidelity OneTaq® QuickLoad® 2X Master Mix (New England Biolabs), appropriate forward and reverse control primers (both 0.4 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... chromatin and chromatin bound fractions were released from magnetic beads using binding buffer containing 5 mM CaCl2 plus an excess (2000 units/ 20 mL reaction) of micrococcal nuclease (MNase; NEB, M0247S) Beads were incubated for 5 minutes at 37 °C with shaking (1250 rpm) ...
-
bioRxiv - Biochemistry 2020Quote: Mutagenesis of the 5-HT2C construct was performed according to the Q5® site-Directed Mutagenesis Kit protocol (New England BioLabs). In brief ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Cell Biology 2019Quote: 40pmol of single stranded oligonucleotide was labelled at the free 5’-OH group with 20 units of T4 polynucleotide kinase (NEB # M0201) in a 50 μl reaction volume containing 1X polynucleotide kinase buffer and 30 μCi γ32P ATP at 37°C for 30min ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The Nested PCR product (5 μl) was digested with NciI restriction enzyme at 37°C for 15 min (New England Biolabs, USA). The final digested DNA fragments was resolved in 2.5 % gel electrophoresis stained with ethidium bromide and visualized with Bio-Rad gel doc XR (Molecular Imager ...
-
bioRxiv - Molecular Biology 2021Quote: ... were heated to 65°C and slow-cooled to 37°C before reverse transcription with 5 U AMV-RT (NEB, M0277L) at 42°C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Genomics 2022Quote: ... chromatin was digested overnight at 37°C with the addition of 25 μL 10X NEBuffer2 and 100U (5 μL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62°C to inactivate the HindIII ...
-
bioRxiv - Cell Biology 2020Quote: A synthetic miR-409-5p oligo was 5’ end-labelled with γ-P32 ATP using T4 polynucleotide kinase (New England Biolabs) and purified using G-50 columns ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 µl of this DNA mixture and 2.5 µl of UltraPure water was added to 5 µl of NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621) on ice ...
-
bioRxiv - Developmental Biology 2022Quote: ... The regulatory sequences of Crbn were PCR amplified from genomic DNA (primers in Supp Table 5) and cloned into a pCESA vector upstream of H2BGFP coding sequences using the restriction enzymes AscI and NotI (NEB England). Mutations into the Snail binding motif of the Crbn regulatory sequences were obtained by recombination using NEBuilder (NEB England ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 pmol dephosphorylated RNA was 5’ phosphorylated with 32P from γ-32P ATP (Hartmann Analytic) with T4 PNK (New England Biolabs) in 1x PNK buffer in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Toe-printing reactions were carried out in 5-µl aliquots containing a PURExpress transcription-translation coupled system (New England Biolabs, USA) to which the test template was added (16) ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of the enzyme was used in the 50 μl-reaction containing 5 μl of rCutSmart Buffer (10X, NEB # B6004S) for 30 min-incubation at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Genetics 2022Quote: ... ds-DNA was constructed from two oligos that are annealed and 5’ overhangs filled in using Klenow polymerase according the manufacture’s specifications (NEB cat. M0210L). All yeast transformation were carried out using the lithiumacetate method ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by treatment with DNase I.5 The samples were then purified with the Monarch® RNA Cleanup Kit (New England Biolabs).