Labshake search
Citations for New England Biolabs :
3351 - 3400 of 6746 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The resulting plasmid will be referred to as pBd-phoD-HA-BSD.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The homology and guide RNA were inserted as described for pBdEF-Cas9-BSD-phodR ...
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 7,500 cells were diluted with 1.25 ml of a dilution buffer containing 0.4x NEBuffer 2 (NEB, B7002S), 2 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... with the inserts at 2 fold molar excess followed by multiple transformations into NEB stable competent E.Coli (NEB) to ensure at least 20x coverage of colonies for every sgRNA ...
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then digested by adding 2μL LysC (500ng/μL, Pierce) for 2 hours then 6μL trypsin (100ng/μL New England Biolabs) overnight ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Cell Biology 2023Quote: ... beads were equilibrated in 1x PMP buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, pH 7.5; New England Biolabs). Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed the SNAP-tag labeling in vivo with 2 μM SNAP-Cell TMR-Star (New England Biolabs) and visualized histones incorporated into chromatin after a pre-extraction of soluble histones before fixation with 2% paraformaldehyde for 20’ as 32 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... These two oligos were ligated with splint oligo1 at 37°C for 2 hours using T4 ligase (NEB; 1U/ml T4 DNA ligase and 13 T4 DNA ligation buffer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 1:1 combination of oligodT 18 primers and random hexamers (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl 10× T4 PNK buffer and 1 μl T4 PNK enzyme (NEB) at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314) in the reaction buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of BsaI-HFv2 and 1 μl of T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was further adjusted with dTTP (1 µl, 1 mM) (NEB #N0443S), TdT reaction buffer (1 µl) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl of DNAse I at 1 mg/ml (NEB, cat no. M0303L), 1 μl RNAse at 10mg/ml (NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the resulting cell pellet was resuspended in 1 mL of RNA Protection Buffer (1× NEB DNA/RNA Protection Reagent, 1% (w/v) polyvinylpyrrolidone-40 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 0.5 µl of 1 mg mL−1 purified bovine serum albumin (1:20 dilution in dH2O of BSA, Molecular Biology Grade 20 mg ml−1, NEB cat. B9000), 0.25 µl of T4 DNA ligase at 400 U µL−1 (NEB cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with the oligonucleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit 5 µg user manual (NEB #T1030). Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genetics 2021Quote: ... Custom inverse complementary adapters that had inverse complementary terminal modifications to ensure unidirectional ligation (3’-T overhang and 5’ phosphorylation) were ligated onto both ends of the respective subsets using the Ultra II Ligation Module (NEB, USA) according to manufacturer’s instructions and purified with 1:1 bead cleanup (Figure 3) ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Synthetic Biology 2021Quote: SynHox assemblon BACs were verified by digesting a ∼250-500ng purified by alkaline lysis (72) from small scale (5-10 mL) saturated bacterial culture with PvuI-HF (New England Biolabs R3150S). Digestion reactions were carried out at 37°C for 3-24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Neuroscience 2020Quote: ... the 5’-homology arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genomics 2021Quote: ... Purified DNA was subjected to an initial step of PCR amplification consisting of 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) and standard barcoded primers of Nextera kit for each sample ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...