Labshake search
Citations for New England Biolabs :
3301 - 3350 of 3625 citations for 5 Fluoro 2 piperidin 2 yl 1H benzimidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: Randomly biotinylated DNA templates for TECprobe-ML experiments were PCR amplified from a 5’ biotinylated linear DNA template using Vent (exo-) DNA polymerase (New England Biolabs) and primers HP4_5bio.R and PRA1_NoMod.F (for ZTP and fluoride templates ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Microbiology 2022Quote: ... (5’-Phos-GAUCGUCGGACUGUAGAACUCUGAAC-3’-InvdT) was ligated to the 3’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... were annealed to an oligonucleotide containing the antisense of the 3’ restriction site (5’-GGT TGA TTA TCG ATA AGC TT-3’) and extended using Klenow Polymerase devoid of exonuclease activity (NEB). Resulted fragments were inserted into the pAAV-CAG-hFXN plasmid between the stop codon of the hFXN and poly A signal ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-ends of the DNA linkers and the rRNA were deadenylated by 5’-deadenylase and the excess linkers were degraded by DNA-specific RecJf exonuclease (NEB). rRNA was reverse transcribed using a linker-specific primer and Protoscript II RT (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Base editing sgRNA directed against the SF3B1 K700 locus was designed using BE-Designer28 and cloned into pLKO.5 Puro-2A-GFP between BsmBI (New England Biolabs) cut sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... the hU6-pegRNA2-polyT cassette was amplified from the pU6-pegRNA-gg-acceptor backbone and ligated into ngRNA1 pLKO.5 Puro-2A-RFP between EcoRI and XhoI (New England Biolabs) to create pLKO.5-K700E-ng1+pg2-Puro-2A-RFP ...
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Neuroscience 2024Quote: ... the tissue was incubated in 5 mL of a clearing solution comprising Clearing Premix (Vizgen, PN 20300003) and 50 μL Proteinase K (New England BioLabs) at 37°C in a humidified benchtop incubator until the tissue was cleared.
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... 120 µL 10x T4 DNA ligase buffer and 5 µL of 400 U/µL T4 DNA ligase (New England Biolabs) was added ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
Recurrent loss of crossover interference punctuates the recombination landscape across yeast speciesbioRxiv - Genomics 2024Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Biochemistry 2024Quote: ... GoldenGate reactions were performed with 5 U of restriction enzyme and 200 U of T4 ligase in T4 ligase buffer (NEB) also containing 0.1 mg/ml BSA (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each of the synthesized DNA fragments was amplified by PCR and inserted at the 5’ of the GFP gene in the pPha-NR vector (NovoPro Bioscience) using NEBuilder HiFi DNA Assembly (New England BioLabs). Five μg of the pPha-NR constructs were introduced into P ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments were then 5’ phosphorylated in a 50 μL reaction containing 10 U of T4 polynucleotide kinase (NEB) and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Cell Biology 2023Quote: MBP-tagged RH domain was isolated via passing cleared lysate over a gravity amylose resin column containing 5 mL of settled resin (NEB). Column was washed with 150 mL of buffer before eluting protein with wash buffer supplemented with 20 mM maltose ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Subsequently ...
-
bioRxiv - Biochemistry 2023Quote: ... The polyadenylated tail was added by incubation with 5 U of poly-A polymerase (New England Biolabs Inc., Massachusetts, USA) for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Bioengineering 2023Quote: ... the 5’ end of each oligonucleotide to be ligated was phosphorylated using T4 Polynucleotide Kinase (T4PNK) (New England Biolabs: M0201) at 1 U/25 pmol ends incubated at 37 °C for 90 minutes followed by a 65 °C heat shock for 20 minutes ...