Labshake search
Citations for New England Biolabs :
3101 - 3150 of 6746 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Microbiology 2020Quote: ... The fluorescently labeled fragment was combined with the 5′ and 3′ unmodified RNAs by DNA-splinted RNA ligation using T4 DNA ligase (New England Biolabs) and purified by denaturing polyacrylamide gel electrophoresis ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5’-phosphorylated) using dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... were generated by PCR amplification of either full-length pfget4 or nucleotides encoding for the first 246 amino acids of PfGet2CD using PfGet4-EcoRIF (5’-GTACCGGAATTCATGAAAAAGTTCAAATTTAGTAAAGAAAAGCTAGCC-3’)/PfGet4-XhoISalIR or PfGet2CD-BamHIF (5’-GTACGCGGATCCATGGATAAAAATACATTAAAAAGAA-3’)/PfGet2CD-XhoISalIR (5’-AGACCGGTCGACCTCGAGTTATTCATGTTTCGTAATAATAAATTG-3’) primer pairs and subsequently cloning at corresponding sites in pMALc2X plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... and reverse primer harboring ApaI site (5’- TATAGGGCCCTGCAATTTTTGGCTATG-3’) of the corresponding DNA sequence from pNL43 into the linearized pMiniT 2.0 vector (NEB, USA) as per manufacturer-recommended protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5’-phosphorylated) using a dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... a lentiCRISPRv2 derivative containing an optimized scaffold (5’-GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTT-3’)40 were digested sequentially with NheI and BamHI (New England Biolabs). The vector and fragment were purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... for 5 minutes at 37°C for TIR-FM imaging or 1μM permeable SNAP-Cell 647-SiR (New England Biolabs, #S9102S) for 15 minutes followed by a 15 minute wash in cell culture media for confocal imaging ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5’-phosphorylated) using dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Biophysics 2020Quote: ... Each mix was incubated at 90°C for 5 min and annealed in 1x T4 DNA Ligase Reaction Buffer (B0202S; NEB) by gradual cooling ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: The cleavage reactions of the FIS & H-NS nucleoprotein complexes were carried out for 5 min with BamHI (New England BioLabs) restriction enzyme for 10 min at 37 °C in the standard New England BioLabs CutSmart buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... “Classic” RRBS library preparation was performed by digesting 5 ng of genomic DNA with 30 units of MspI enzyme (New England BioLabs), and fragments were ligated to pre-annealed adapters containing 5’-methyl-cyotosine ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Neuroscience 2022Quote: ... Ligation was done overnight at 16°C also rotating at 900 rpm for 10 seconds every 5 minutes by adding 120 µl of 10X ligation buffer (NEB), 664 µl water ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Biochemistry 2022Quote: ... transcripts containing artificial 5’ UTRs were performed using PCR-amplified templates and the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... the sRNA fraction (∼15- 35nt) was isolated by gel extraction and RNA species bearing 5’-OH were monophosphorylated by T4 polynucletide kinase (NEB). This was followed by treatment by a terminator exonuclease (Epicentre) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 3’ RNA adapter /5’Phos/rArGrArUrCrGrGrArArGrArGrCrArCrArCrGrUrC/3’SpC3 was ligated to the samples using T4 RNA Ligase (NEB, M0437M) at room temperature for 75 min.
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Biochemistry 2022Quote: ... the recessed 3’ end was filled-in using a fluorescently labeled deoxynucleotide complementary to the 5’ most deoxynucleotide of the TO using the DNA Polymerase I Large (Klenow) Fragment (New England Biolabs). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using specific primers containing a 5’ T7 promotor sequence adapted to both forward and reverse primers and Taq polymerase (NEB). PCR products were purified using the GeneJET PCR Purification kit (Thermo Scientific ...
-
bioRxiv - Genetics 2022Quote: ... the TSS/Promoter region was amplified by PCR using Illumina compatible primers (TE127 and TE111) from 5 ng plasmid using Phusion HF polymerase (NEB). Sequencing results were analyzed using custom Python scripts to quantify the frequency of each 7 nt TSS sequence.
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Genetics 2022Quote: ... then the single nucleotide (A) was added to the end of the digestive fragment by Klenow fragment (3’-5’ exo-) (NEB) with dATP at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... was generated by the assembly of 5 DNA fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs). These DNA fragments ...
-
bioRxiv - Microbiology 2020Quote: ... encoding C1-INH amino acid residues 98-500 with Kozak and BiP signal sequence at 5′ end (GeneArt, ThermoScientific) was cloned using Gibson assembly (New England Biolabs) into pExpreS2-1 (ExpreS2ion Biotechnologies ...
-
bioRxiv - Microbiology 2021Quote: ... From AF293 genomic DNA we amplified a ~4 kb fragment that included ~1kb 5’ and ~200 bp 3’ of sskA and introduced PacI and NotI (New England Biolabs) restriction sites at the 5’ and 3’ ends ...
-
bioRxiv - Developmental Biology 2021Quote: DNA probes were generated by annealing 5’ IRDye®700 labeled forward oligonucleotides with unlabeled reverse oligonucleotides (Integrated DNA Technologies) to a final concentration of 5 μM in PNK buffer (New England Biolabs). One hundred femtomoles of labeled IRDye®700 probes were used in a 20-μl binding reaction containing 10 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2021Quote: ... For cloning the oligo pool into the appropriate lentiviral backbone the following reaction was set up: 5 μl 10x Cutsmart buffer (NEB), 1 mM DTT (final) ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Microbiology 2020Quote: ... The efgA coding sequence plus 30 bp at the 5’ end was amplified using primers with 30 nt overlaps to permit Gibson assembly (HiFi DNA Assembly, New England Biolabs) into pAH120 [40] that had been digested with XbaI and NdeI ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were lysed in 60 µL CHAPS lysis buffer and 20µL incubated on ice with 5 units of TEV protease (New England Biolabs, P8112) for 30 minutes at which time 5 µL 6x SDS sample buffer was added to 20 µL of the digested and undigested sample and boiled at 95° C for five minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Chromatin was then digested by adding 12 μl of 10x NEBuffer3.1 and 8 μl of 5 U/μl DpnII (NEB, R0543) followed by a 2h incubation at 37ºC in a ThermoMixer with shaking (900 rpm ...
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England Biolabs) following manufacturers’ protocols ...
-
bioRxiv - Genomics 2022Quote: RNA samples from 2 differentiation time courses with 5 time points were used to synthesize full-length barcoded cDNA libraries using the Template Switching RT Enzyme Mix (NEB). Libraries were prepared using Pacific Biosciences protocol for cDNA Sequence Capture Using IDT xGen® Lockdown® probes (https://eu.idtdna.com/site/order/ngs) ...
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Systems Biology 2019Quote: ... followed by the addition of a single dA overhang and ligation of the first adaptor (5′-phosphorylated) using dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs) ...
-
bioRxiv - Systems Biology 2019Quote: ... using the same method as the LC-MS/MS method described below for Dimroth rearrangement analysis following hydrolysis into nucleosides by RNA 5’ pyrophosphohydrolase (RppH, NEB) and shrimp alkaline phosphatase (SAP ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Cell Biology 2019Quote: ... the M2×24 array was cloned into the pUBC-HaloTag-bActinCDS-bActinUTR-MS2V5 using 20 bp of 5’ and 3’ homology to replace the MS2 cassette using the Hifi builder enzyme mix (NEB). This was later followed by further Gibson assembly of the Halo-bActinCDS-bActinUTR-M2×24 insert into the pLenti-puro backbone using NEB Hifi builder ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’ RNA linkers with four terminal random nucleotides were then ligated to the small RNAs using T4 RNA ligase (NEB) followed by an SPRI magnetic bead purification (in-house-produced beads similar to Agencourt RNAclean XP) ...
-
bioRxiv - Biochemistry 2019Quote: ... encoding the reverse complement of the Illumina Read1 primer binding site (R1R) using Thermostable 5’ AppDNA/RNA Ligase (New England Biolabs). Ligated cDNAs were re-purified with MinElute Reaction Cleanup Kit and amplified by PCR for 12 cycles using Phusion DNA polymerase (Thermo Fisher Scientific ...