Labshake search
Citations for New England Biolabs :
3101 - 3150 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... 1-5 mL of cell pellet was harvested for plasmid extraction with the Monarch Plasmid DNA Miniprep Kit (New England Biolabs) (T1010) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ and 5’ ends were modified accordingly and the respective adapters were ligated with a T4 RNA ligase I (New England Biolabs). The final products were size-selected one last time and rRNA depletion was performed using custom-made biotinylated oligos(38 ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro RNA transcription was performed in 50 µl reactions: 5 µl RNAPol Reaction Buffer (New England BioLabs, Ipswich, MA), 2 µl T7 RNA Polymerase (New England BioLabs ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Microbiology 2024Quote: The 5’ end of the sigAb transcript was identified using 5’ RACE following manufacturer’s protocol with template switching RT enzyme mix (NEB; M0466). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µM purified SNAP-tagged proteins were reacted with 10 µM biotin-conjugated benzylguanine (BG-bio) (S9110S; New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... were cloned in the EcoRI-BamHI digested and gel purified pTCV vector with 5 000 units of T4 DNA ligase (HC, New England Biolabs) incubated at 16°C overnight ...
-
bioRxiv - Physiology 2024Quote: ... Stranded mRNA-Seq library construction was carried out using 5 μL of purified mRNA (15-75ng) and NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs). First and second strand cDNA synthesis ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Plant Biology 2024Quote: ... the full length coding sequences of cowpea VuLHY1 (Vigun10g1533300) and VuLHY2 (Vigun09g004100) were amplified from a 5’ RACE cDNA library using the Q5 High-Fidelity DNA polymerase (NEB) and specific primers (Table S1) ...
-
bioRxiv - Microbiology 2024Quote: ... was mixed with an 80-mer spike-in RNA oligonucleotide internal standard (DNA and RNA oligonucleotide sequences in Table S5).5 The mixture was dephosphorylated shrimp alkaline phosphatase (rSAP, NEB) in NEB T4 RNA ligase buffer at 37 °C for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... in the HA head (H3 numbering 52-263) of A/Sydney/5/2021 was assembled using golden gate cloning (BsmBI-v2 Golden Gate Mix, NEB) with a barcoded segment into pDM_RevGen068 ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 µCi) ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was then amplified for 5 cycles with ATAC index primers and NEBNext Ultra II Q5 Master Mix (NEB #M0544). Additional amplification cycles were then determined by qPCR using 5uL of original amplification with PerfeCTa SYBR Green FastMix Reaction Mixes (Quantabio 95072-012) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% Nonidet P-40) and incubated with pre-washed anti-D-lactyllysine antibody-conjugated protein A agarose beads (PTM Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The final HiC library was generated with 5 PCR cycles using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Dual Index primers (NEB) for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... after removing the Gel Coverslip, slides were incubated in 5 ml warmed Clearing Solution (ref. 20300003, Vizgen) with Proteinase K (ref. P8107S, NEB) in a sealed petri dish for 24 hours at 37°C.
-
bioRxiv - Developmental Biology 2024Quote: ... the RNA was ligated to the 5’ adapter from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adapter-ligated RNA was reverse-transcribed using SuperScript II (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of BL21 competent cells (or, in the case of the disulfide stabilized cspg binders, T7 shuffle express) (NEB) were dispensed onto the 1 µL reactions ...
-
bioRxiv - Cell Biology 2024Quote: ... the cDNA library was cleaned using the Monarch PCR & DNA Cleanup Kit (5 μg) (T1030L, New England Biolabs, MA, USA) using the 7:1 ratio of binding buffer:sample as per the manufacturer’s instructions and was eluted in 27.5 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μL of the product was transformed by heat shock into 10-beta competent cells (New England Biolabs, C3019I). Cells were then plated on agarose plates (supplemented with ampicillin 100 μg/mL ...
-
bioRxiv - Genomics 2024Quote: ... CHART-enriched DNA was eluted twice in 200 μL of elution buffer supplemented with 5 U/μL RNase H (New England BioLabs) at room temperature for 20 min ...
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Cell Biology 2024Quote: The full-length open reading frame of SYP-5 was synthesized as a gBlock (IDT) and cloned into pMAL (New England Biolabs) to express Maltose-binding protein (MBP)-tagged SYP-5 with a 6xHis tag at the N-terminus ...
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified RNA redissolved in 5 µl of 10% (v/v) DMSO was combined with 1x T4 RNA Ligase Buffer (New England Biolabs), 0.5 U/µl SuperaseIN (Invitrogen) ...
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Genomics 2024Quote: ... The purified PCR was digested overnight at 37°C in a 120 μL reaction (5 μL BsaI-HF (NEB R3733L), 5 μL BlpI ...
-
bioRxiv - Cancer Biology 2024Quote: ... Site-directed mutagenesis of SOX10 5’UTR was performed using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, #E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Bead-bound microglial nuclei were resuspended in 25 µL Antibody Incubation Buffer (995 µL Wash Buffer with 5 µL 200x BSA [B9000S, New England Biolabs]).
-
bioRxiv - Biochemistry 2024Quote: ... Run-off transcription was then performed using 5 ng of PCR amplified template (HiScribe T7 High Yield RNA Synthesis kit; NEB), followed by DNase treatment (TURBO DNase ...
-
bioRxiv - Biophysics 2024Quote: ... Positively supercoiled DNA was prepared by incubating with 9°N Reverse Gyrase (5 units/μg DNA, M0200, provided by New England Biolabs) in 35 mM Tris-HCl (pH 7.5 at 25 °C) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μL of the product was transformed by heat shock into 10-beta competent cells (New England Biolabs, C3019I). Cells were then plated on agarose plates (supplemented with ampicillin 100 μg/mL ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... of which 5 μl was processed with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) with published modifications to the manufacturer’s protocol (Batty et al ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... Genes of interest were cloned to Gateway™ pENTR™ 4 Dual Selection Vector (A10465) by NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621L) and cloned to a pUC19 expression vector powered by the maize ubiquitin promoter (ZmUBI ...
-
bioRxiv - Biochemistry 2024Quote: ... R3104L) for SMG6-3xFLAG in reactions containing 40 ng/ μl DNA (4 μg in total) in 1x CutSmart buffer (NEB, Cat No. B7204S) for 2h or overnight at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...