Labshake search
Citations for New England Biolabs :
3001 - 3050 of 4045 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 10 μg genomic DNA was digested with 20 units Sty I (NEB, R3500S) at 37 °C for 3 h ...
-
bioRxiv - Systems Biology 2023Quote: ... Two transformations into NEB 10 beta electrocompetent cells (New England Biolabs, Ipswitch, MA) were performed as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... The Color Protein Standard Broad Range (10–250 kDa) (New England BioLabs Inc.) was used as protein molecular weight ladder ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µg of isolated RNA was treated with DNase I (NEB, Cat: M0303S) to remove any contaminating genomic DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... The lysates were then treated with 10 μl DNase I (New England Biolabs) and incubated at 4°C for 1 hour on a rotator followed by centrifugation at 13,000 rpm ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 µg of purified RNA was immobilized on streptavidin magnetic beads (NEB) for 8 h at 4°C under orbital rotation in binding buffer (24 mM KCl ...
-
bioRxiv - Plant Biology 2024Quote: ... 10 μg of gDNA was digested with SacI restriction endonuclease (New England Biolabs). Digested samples were electrophoresed on a 1% agarose gel stained with SYBR Safe (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions (10 µl) were performed Luna Universal qPCR Master Mix (New England Biolabs). mRNA abundance for each gene was determined relative to GAPDH mRNA using the 2−ΔΔCt method ...
-
bioRxiv - Cell Biology 2024Quote: ... Mutagenic PCR products were then digested with 10 U DpnI (New England Biolabs) at 37°C for 30 min to eliminate template DNA ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were centrifuged at 30,597xg and 4°C for 20min and the supernatant was applied to amylose resin (NEB). The column was washed with 10 column volumes (CV ...
-
bioRxiv - Biochemistry 2020Quote: ... Vector and fragment were ligated in an overnight reaction at 4 °C using T4 DNA Ligase (New England Biolabs). After transformation ...
-
bioRxiv - Cell Biology 2021Quote: ... centrifuged at 58,000 × g for 50 minutes at 4°C and the protein was batch purified using chitin beads (NEB). Protein-bound chitin beads were washed with lysis buffer and high salt buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... The region of interest was amplified with specific primers (see Supplemental Table 4) and the Q5 DNA polymerase (NEB), and indexed by PCR using primers containing Illumina indexes (see Supplemental Table 4) ...
-
bioRxiv - Biophysics 2020Quote: ... T270 plasmid was digested by HpaI at 37°C for 4 hr in the CutSmart buffer (New England BioLabs) to place the (TTAGGG)270 at the middle region of the linearized substrate ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and protein was purified on amylose resin (NEB) including a high salt wash with buffer containing 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates were cleared via centrifugation at 30,597xg and 4°C for 20 min and the supernatant was applied to amylose resin (NEB). The column was washed with 15 column volumes (CV ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the Schizosaccharomyces pombe rad9 intron was synthesized via fusion PCR (4) and inserted between BamHI and PstI (NEB). The N ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated in fresh medium containing 4 μM SNAP-Cell TMR-Star (New England Biolabs, Inc.) for 15 min at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed on 4 ng of pKD3 plasmid using Q5 High-Fidelity 2X Master Mix (New England Biolabs). The PCR product was digested for 1 hour with the restriction enzymes DpnI and ClaI at 37°C and then the PCR product was run on a 1% agarose gel ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... sequence in a reaction containing 40 ng/μl DNA (4 μg total) and 0.5 U/μl restriction enzyme (HindIII-HF; NEB, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 5’ arm of homology to exon 5 of the Il22 gene was cloned into NotI-EcoRI-digested pMACs 4-IRES.II (contains EMCV IRES and truncated hCD4) using T4 DNA Ligase (NEB). Second ...
-
bioRxiv - Biophysics 2020Quote: ... After 1 hour of centrifugation at 100,000xg at 4 °C the supernatant was incubated with Chitin resin (New England Biolabs) for 30 minutes at 4 °C to remove metalloproteases ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Barcodes (4-8 bp) and common adapters were ligated with 400 U T4 DNA ligase (New England Biolabs Inc.) at 22 C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... The ligation of vectors with gRNA inserts was performed overnight at 4°C using T4 DNA ligase (NEB, M0202). The ligation products were then transformed ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Genomics 2022Quote: ... We then amplified barcodes from both cDNA and DNA in 4 PCR reactions per sample using Q5 (NEB #M0492) and primers specific to the reporter genes (GWLP P3 ...
-
bioRxiv - Genetics 2023Quote: ... digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µL T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Microbiology 2023Quote: ... Reactions were set up as per manufacturer’s instructions with the addition of 4 units of Murine RNase Inhibitor (NEB) and 5% DMSO ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAs were eluted by mixing the beads with 21µl RNase H Elution Buffer and 4 µl RNase H (New England Biolabs) and incubated at 37 °C for 30 min while shaking ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Immunology 2024Quote: ... MO were stored at 4°C in water at 1 mM and diluted for injections with 0.5X CutSmart Buffer (NEB) and 0.1% phenol red ...
-
bioRxiv - Bioengineering 2024Quote: S-R1-R2-H stock (87.5 kDa, 2 - 4 μM) tagged with handle oligos was reconstituted in 1x T4 ligase buffer (NEB) in PBS with 0.05% NP-40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... ChIP-seq libraries were prepared from 3-5ng ChIPed DNA using NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: The small RNA sequencing libraries were constructed using 3 μg total RNA per sample and NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB) following the manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Genomics 2022Quote: ... to 5 μg of input DNA (in total volume of 24 μl at >210 ng/μl) with 3 μl 10X CutSmart Buffer (NEB, Cat #B7204), and incubating for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...