Labshake search
Citations for New England Biolabs :
251 - 300 of 2145 citations for SARS CoV 2 Spike Glycoprotein S1 RBD His Tag CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The homology plasmids were assembled using HI-Fi DNA Assembly Mastermix (NEB) with four PCR-generated DNA fragments (see Table S2 for primers) ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified and then cleaved with Xho I and Bam HI (both NEB). After further purification ...
-
bioRxiv - Microbiology 2022Quote: ... and then ligated by Hi-Fi DNA assembly (New England Biolabs Inc.). Irgb6-WT and Irgb6-T95D were expressed and purified as described (Saijo-Hamano et ...
-
bioRxiv - Biochemistry 2023Quote: ... was cloned into pUC19 by Gibson cloning (Hi-Fi cloning system, NEB) to replace the yeast sequence:
-
bioRxiv - Biophysics 2019Quote: ... 27P-XhoI-A and XbaI-A oligonucleotides (Table S1) were biotin or digoxigenin tailed using Terminal Transferase (NEB) and either BIO-dUTP or DIG-dUTP ...
-
bioRxiv - Plant Biology 2020Quote: ... Table S1) were used to amplify GmSALT3 cDNA with Phusion® High-Fidelity DNA Polymerase (New England Biolabs) using 35 cycles (98 °C 30 s ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... using the primers outlined in Table S1 and Q5 Hot-start high fidelity polymerase (New England Biolabs M0494S). PCR products were extracted from standard agarose gels using the QIAquick Gel Extraction Kit (Qiagen 28704 ...
-
bioRxiv - Developmental Biology 2023Quote: Plasmids (otxG:Tet-ON 3G; TRE3Gs:Cas9; TRE3Gs:Kaede; U6:sg2; Table S1) were built by Gibson cloning (NEB, Cat# E2611) following standard protocols ...
-
bioRxiv - Biochemistry 2020Quote: ... Tag introduction and mutagenesis was achieved through Gibson assembly (New England Biolabs) to generate SMC1-His ...
-
bioRxiv - Microbiology 2022Quote: ... Affinity tags were introduced by NEBuilder HiFi DNA Assembly Cloning Kit (NEB) into the expression vectors encoding Rae1 and Nup98 using primers in Table 1 ...
-
bioRxiv - Biophysics 2021Quote: ... and the His6-MBP tag was subsequently recaptured using amylose resin (NEB). The flow-through was loaded onto a Q-HP anion exchange column (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: ... and subsequently the 6xHIS tag was cleaved using the TEV Protease (NEB) by adding TEV enzyme assuming all protein isolate was 6xHIS tagged based on the activity of the TEV protease ...
-
bioRxiv - Biochemistry 2023Quote: ... and SNAP tags were stained with SNAP-Cell® 505-Star (NEB). HaloTag® Ligands TMRDirect were added to medium to a final concentration of 50nM and incubated overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 3XFLAG tag was replaced by Q5® site-directed mutagenesis (NEB) with either a Myc-tag or Strep-tag®II ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins with MBP-tag were loaded onto amylose resin (New England Biolabs) after elution from Ni-NTA ...
-
bioRxiv - Immunology 2021Quote: ... The template for in vitro transcription was a PCR amplicon from the pLMCT-RBD-6His produced using the PHUSION high fidelity DNA polymerase (NEB) and TGTGGAATTGTGAGCGGATA as forward primer and CTTCACTATTGTCGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA as reverse primer.
-
bioRxiv - Synthetic Biology 2021Quote: ... Primers flanking the transgene were then used to amplify the entirety of the RBD::mClover coding region using Q5 DNA polymerase (New England Biolabs). PCR amplicons were size-verified by electrophoresis on a 0.8% TAE agarose gel stained with SYBR Safe (Thermo Scientific ...
-
bioRxiv - Biochemistry 2020Quote: Ten micrograms of purified RBD proteins were treated by 500 units of PNGase F (New England Biolabs, Ipswich, USA #P07045) according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: DNA sequences for plasmids pACL002-pACL006 and Design1_pETconV4-Design7_pETconV4 containing all RBD design sequences were ordered as gBlocks (IDT) and cloned into pETconV4 using restriction enzymes NdeI and XhoI (NEB).
-
bioRxiv - Immunology 2021Quote: The cDNA sequences of the paired variable heavy and light chain region of anti-RBD antibody clones were synthesized as gBlocks (IDT) and cloned by the Gibson assembly (NEB) into human IgG1 heavy chain and light chain expression plasmids ...
-
bioRxiv - Molecular Biology 2022Quote: Full-length CDS of candidate RBPs and DNA fragments covering the RBDs were PCR amplified from cDNAs reverse-transcribed from Col-0 mRNA using the Phusion DNA Polymerase (NEB), and cloned into the pMCSG9 vector using the ligation-independent cloning (LIC ...
-
bioRxiv - Immunology 2021Quote: ... The kRSV-DB1-QUAD plasmid and spike insert were digested with the enzymes AatII and SalI (NEB) and ligated with T4 DNA ligase (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Complexes were prepared by incubating spike ectodomain preparations with either ACE2 (residues 18–615, New England Biolabs), VH ab8 ...
-
bioRxiv - Microbiology 2022Quote: ... Spike variants with single-site residue substitutions were generated using Q5® High-fidelity DNA polymerase (NEB)-based site-directed mutagenesis.
-
bioRxiv - Genetics 2021Quote: ... primers P1 and P2 (Table S1) were used with the Q5 Hot Start High-Fidelity 2X Master Mix (NEB). To ensure coverage for each sample ...
-
bioRxiv - Plant Biology 2021Quote: ... We amplified the corresponding cDNAs using the primers on Table S1 and Q5® High-Fidelity DNA Polymerase (NEB). The PCR fragments were cloned into pENTR-D Topo vector and sequenced.
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using pBluescript SK+ CPES_V5 clone as template with appropriate sense and antisense primers (Table S1) and Phusion polymerase (NEB). The PCR product was digested with DpnI to remove templates followed by transformation into DH5α competent cells ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using pBluescript SK+ CPES_V5 clone as template with appropriate sense and antisense primers (Table S1) and Phusion polymerase (NEB). The PCR product was digested with DpnI to remove templates followed by transformation into DH5α competent cells ...
-
bioRxiv - Bioengineering 2022Quote: ... custom synthesized oligonucleotides encoding the sgRNA spacer sequences (IDT) (Supplementary Table S1) were phosphorylated by T4 polynucleotide kinase (NEB) for 30 min at 37°C and subsequently annealed in a thermocycler (5 min at 95° ...
-
bioRxiv - Immunology 2020Quote: ... Ighγ1 heavy-chain sequences were amplified in a nested PCR using primers for the Ighγ1 constant region together with a specific primer for VH186.2 (Mayer et al., 2017)(Table S1) and using high-fidelity Q5 polymerase (NEB). Amplified products were cloned (CloneJET PCR Cloning Kit ...
-
bioRxiv - Genetics 2020Quote: ... PCR to amplify the barcode for Illumina sequencing was performed on 2.5 µL of isolated DNA (primers listed in Table S1) with Q5 polymerase (NEB), following manufacturer’s instructions with between 25-35 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... Datafile S1) and introduced into the NheI/BamHI restriction sites of pAAV-MCS2 by Gibson assembly (New England Biolabs). N-BioTAP and N-PrA cassettes targeted the first ATG of the MYC gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pairs of complementary DNA oligos (table S1) were annealed and phosphorylated with T4 polynucleotide kinase [New England Biolabs (NEB)] as previously described (3) ...
-
bioRxiv - Genomics 2023Quote: ... Datafile S1) and introduced into the NheI/BamHI restriction sites of pAAV-MCS2 by Gibson assembly (New England Biolabs). The N-BioTAP cassette was targeted to the first ATG of the MYC gene ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext Hi-Fi 2x PCR Master Mix (NEB (Ipswich, MA, USA) M0541S) ...
-
bioRxiv - Microbiology 2020Quote: ... and ligation with T4 ligase (Bioconcept) or by Hi-Fi Gibson assembly (NEB). PCR were performed using Phusion polymerase (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: His-SpCas9-GFP was expressed in and purified from BL21 (DE3, NEB, C2527H) bacteria as previously described 47 ...
-
bioRxiv - Molecular Biology 2023Quote: Hi-C libraries were treated with 3 U of T4 DNA polymerase (NEB) in the presence of 0.1 mM dGTP (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... His- tagged proteins were purified by NEBExpress® Ni-NTA Magnetic Beads (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and joined into the linearized vector by Hi-Fi Gibson DNA Assembly (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Mutagenized SARS-CoV-2 libraries and pooled wildtype homolog RBDs were cloned into EcoRI-HF/SacI-HF digested pETcon vector (sequence linked above) using NEBuilder HiFi DNA Assembly (NEB E2621). Assembled products were Ampure purified and electroporated into electrocompetent NEB10-beta cells ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells expressing the SNAP-tag and stained with SNAP-cell 647-SiR (NEB) were excited with a white light laser at an excitation wavelength of 633 nm ...
-
bioRxiv - Cell Biology 2019Quote: ... the sequence encoding SNAP-tag was PCR amplified from pSNAPf (New England BioLabs) with primers to append flanking BamHI and NotI restriction sites (Forward ...
-
bioRxiv - Biophysics 2023Quote: From the H6-RapA expression plasmid and pSNAP-tag(T7) plasmid (NEB #101137), we constructed a plasmid pKI1 (Addgene #199118 ...
-
bioRxiv - Biochemistry 2023Quote: ... GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB) by deleting the amino acids (number 169 –181 ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.4 μL Buffer Tag DNA polymerase (5 U/μL, NEB, Cat. No. B9004S), 1.6 μL dNTP (TAKARA ...
-
bioRxiv - Microbiology 2022Quote: ... resulting in a linearized vector into which synthetic variant spike genes can be assembled using Gibson Assembly (NEB). The Gibson Assembly reaction was then transformed into TransforMax™ EPI300™ Electrocompetent E ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of a spike gene fragment was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or 279bp (high cost) of regulatory region (Fig. S1) and cloned into pKD3 upstream of the chloramphenicol resistance cassette using Gibson Assembly (NEB). Primers to amplify hilD contained ∼40bp homology to the sites flanking a NdeI site in pKD3 ...
-
bioRxiv - Molecular Biology 2022Quote: The L3 DNA linker at 0.5 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using 5 U/μl of RNA Ligase Truncated K227Q (NEB) in the presence of 15% PEG8000 and 1 U/μl RNasin (Promega ...