Labshake search
Citations for New England Biolabs :
101 - 150 of 2145 citations for SARS CoV 2 Spike Glycoprotein S1 RBD His Tag CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Cell Biology 2020Quote: ... Glycoprotein denaturation of the cell lysate was performed with 1x glycodenaturing buffer (New England Biolabs) at 95°C for 10 mins ...
-
bioRxiv - Genetics 2019Quote: ... 2012) by removing cbr-Pmyo-2∷gfp∷his-72 UTR by cutting using KpnI and ApaI (NEB). The digested pZZ0031 backbone carrying cbr-unc-119(+ ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... using the primers in (Table S1) by HiFi (NEB) cloning ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S R403T and RaTG13 S T403R/T403A mutant plasmids were generated using Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Biochemistry 2021Quote: Native glycoproteins (10 μg) were digested with 1 U of IMPa (O-Glycoprotease, New England Biolabs) in 50 μL 20 mM Tris-HCl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The SNAP-tag sequence (NEB) was cloned into a β-cell-specific expression vector with a porcine INS gene promoter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... rabbit anti-SNAP-tag (NEB; P9310 ...
-
bioRxiv - Immunology 2022Quote: ... Delta and BA.2 spike plasmids were linearized by restriction enzymes and transcribed to mRNA by in vitro T7 RNA polymerase (NEB, Cat # E2060S) as previously described10.
-
bioRxiv - Cell Biology 2021Quote: ... m6A-modified RNA spike-in controls (New England Biolabs) and a nontargeted region on the crRNA-targeted transcript ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Cell Biology 2022Quote: Lysates (20 μg) and media immunoprecipitates were diluted to 10 μL in 2X glycoprotein denaturing buffer (NEB), and boiled for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... N-linked glycans released from glycoproteins using Peptide:N-glycosidase F (PNGase F, New England Biolabs, Ipswich, MA) were mixed with 2,5-dihydroxybenzoic acid (DHB ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Biophysics 2019Quote: ... SNAP-tag (New England Biolabs Inc.), FLAG-tag and 6 × His-tag were attached at the C-terminal ...
-
bioRxiv - Biophysics 2021Quote: ... SNAP-tag (New England Biolabs Inc.), FLAG-tag and 6 × His-tag were attached at the C-terminal via linkers (3 a.a. ...
-
bioRxiv - Cell Biology 2023Quote: ... SNAP-tag (New England BioLabs, N9181S), HaloTag (Promega ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... and spike-in lambda DNA (1.25 ng) (New England Biolabs) was sheared using the M220 ultrasound sonicator (Covaris ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Microbiology 2023Quote: ... The glycoprotein gene fragments and pCAGGS/MCS DNAs were ligated with Instant Sticky-End Ligase (New England Biolabs) and transformed into competent E ...
-
bioRxiv - Cell Biology 2023Quote: Equal amounts (25 μg) of whole normal muscle extracts were incubated with 1 x Glycoprotein denaturing buffer (Biolabs) at 100 °C for 10 min to denature glycoproteins ...
-
bioRxiv - Genomics 2023Quote: ... The DNA length and RNA absence were assessed by 2% agarose gel electrophoresis (50 V, 90 min) including the Quick-Load 1 kb DNA Ladder (New England Biolabs Inc., Ipswich, USA; Text S1). The extracted gDNA was not fragmented and larger than 10 kb (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB). Finally ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Immunology 2021Quote: ... Two restriction sites NheI at the 5’ end and BamHI at the 3’ end were incorporated into the CD4-polypeptide linker plasmid which was then inserted into pACP-tag(m)-2 plasmid (New England Biolabs) to obtain pACP-CD4 ...
-
bioRxiv - Biophysics 2020Quote: ... The construct was amplified by PCR and inserted into pSNAP-tag®(T7)-2 vector (New England Biolabs Inc. #N9181S) with a SNAPf-EGFP-6His cassette ...
-
bioRxiv - Biophysics 2022Quote: SNAP-tag labeling of SNAP-mGluR2 was done by incubating cells with 2 µM of SNAP-Surface Alexa Fluor 549 (NEB) and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA chimera was then cloned into the pACP-tag (m)-2 vector (addgene# 101126) using NheI and NotI (NEB) as the restriction sites ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... mRNA coding for RBD was synthesized per manufacturer recommendation using Hiscribe T7 (NEB) with co-transcriptionnal CleanCap AG (Trilink) ...
-
bioRxiv - Immunology 2021Quote: ... The RBD-6his coding sequence was amplified by PCR using PHUSION polymerase (NEB) and TAAACTTAAGACAACCATGGTCGTGTTTCTGGTGC as a forward primer and GGGGATCCcGTCTTCCTCGAGTTATCAATGGTGATGGTGA as reverse primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Microbiology 2020Quote: The plasmid pAAV S1-Fc was digested with New England Biolabs (NEB) Restriction Enzymes Pvu I-HF (Cat ...
-
bioRxiv - Genomics 2022Quote: ... specific primers (Supplementary Table S1) were radiolabelled with T4 Polynucleotide kinase (NEB) and [?-32P]ATP (6,000 Ci/mmol) ...
-
bioRxiv - Cell Biology 2020Quote: 100μg of each P13 and P40 sample was resuspended with 20μL of 1X glycoprotein denaturing buffer (New England BioLabs) and incubated at 100°C for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Developmental Biology 2021Quote: 4mC and 5mC spike-in controls were generated from pUC19 (NEB) PCR product synthesized with N4-methyl-dCTP (4mdCTP ...
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-SNAP-tag (New England Biolabs, #P9310S) and anti-Cyclin D1 (BD Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: ... or SNAP-tag (New England BioLabs, N9181S) were inserted into the retroviral plasmids pMRX-IP (harboring a puromycin-resistant marker ...
-
bioRxiv - Genetics 2020Quote: ... anti-MYC-tag (Cell Signaling Technology/NEB) at 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... SNAP-tag DNA (pSNAPf, New England Biolabs) and β-Actin DNA (Actin mRFP-PAGFP was a gift from Guillaume Charras & Tim Mitchison ...
-
bioRxiv - Cell Biology 2023Quote: ... and SNAP-tag (New England BioLabs, N9181S) were used for tagging ...
-
bioRxiv - Microbiology 2024Quote: ... the SNAP tag (New England Biolabs #N9183S) was inserted after the Ptet or Plac promoter with the appropriate primers (supplementary methods) ...
-
bioRxiv - Cell Biology 2020Quote: ... S141A ABHD11 and H296A ABHD11 with C-terminal eGFP tags or HA tags were created using NEBuilder HiFi (NEB). ABHD11 was also cloned into a transfection vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...