Labshake search
Citations for New England Biolabs :
251 - 300 of 4239 citations for Recombinant Human FCGRT & B2M Protein His Strep II tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Protease Inhibitors) with recombinant PKA kinase (2500 U/mg, NEB-P600S) and 1 mM ATP overnight at 30°C and 250 rpm ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Biophysics 2022Quote: Nucleosome reconstitution was performed by salt dialysis on biotinylated DNA (pKYB1 vector; New England Biolabs) without any nucleosome positioning sequence ...
-
bioRxiv - Developmental Biology 2022Quote: ... The biotinylated DNA was ligated in a reaction mixture containing 1x ligation buffer (NEB, B0202), a final concentration of 1% Triton X-100 ...
-
bioRxiv - Genomics 2021Quote: ... Selected biotinylated DNA fragments ranging from 200-500bp were then ligated with illumina adaptors (NEB). The libraries obtained from biological replicates were multiplexed and further sequenced at Oxford Genomics Centre and Edinburgh Genomics (Genepool ...
-
bioRxiv - Systems Biology 2023Quote: ... Biotinylated oligo tags were amplified on-bead using 2X Q5 Hot-Start Mastermix (NEB #M0494) with primers that add the indexed full Illumina adaptor sequences.
-
bioRxiv - Plant Biology 2023Quote: ... Total mRNAs were isolated using biotinylated oligo(dT) and streptavidin magnetic beads (New England Biolabs) as previously described (Wang et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... The complete insert region was PCR amplified using Q5 Hi Fidelity DNA polymerase (NEB) and the amplicon sequenced at high coverage using Illumina MiSeq in the Complete Amplicon Next-Generation Sequencing service from the MGH CCIB DNA Core (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were conducted using NEB Phusion Hi Fi Polymerase (New England Biolabs, Ipswich, MA). Reactions were comprised of 4 µl 5X Phusion Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were conducted using NEB Phusion Hi Fi Polymerase (New England Biolabs, Ipswich, MA). Reactions were comprised of 4 µl 5X Phusion Buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C to remove of biotin from non-ligated fragment ends ...
-
bioRxiv - Microbiology 2021Quote: ... The expression vector pET302/NT-His was digested with EcoR1 restriction enzyme (NEB R0101S) and run on a 1.5 % agarose gel ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 µg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). PCR reactions were performed with the Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... These were used in a PCR reaction with Q5 Hi-Fidelity polymerase (NEB, USA) in combination with the pLuc-GAL5.1 reporter construct previously described 8 as template to produce pLuc-GALΔEGR ...
-
bioRxiv - Genomics 2019Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the NEBuilder Hi Fi DNA Assembly Master Mix (New England Biolabs, Beverly, MA). For the production of lentiviral particles ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-MBP-Cas12a plasmid was transformed into BL21(DE3) cells (New England Biolabs). A single colony was used to inoculate LB media supplemented with 50μg/ml Kanamycin for an overnight culture grown at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... stained in HI buffer containing 5 μM SNAP-Surface Alexa 647 (New England Biolabs) for 15 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and K723G).49 His/MBP-BRAF NTs were created with standard Gibson Assembly (NEB) procedure in the pET28-MBP vector from the following primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2uL of SuperScript II (NEB M0368L), and 2 uL of water ...
-
bioRxiv - Genomics 2020Quote: ... 0.75 µl Protoscript II (150U; NEB)] at 50°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcribed using Protoscript II (NEB), and quantified using qPCR with primers for renilla luciferase (forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Protoscript II (New England Biolabs) reverse transcriptase ...
-
bioRxiv - Genomics 2019Quote: ... and 20 Units CviA II (NEB) at 25°C for 20 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... reverse transcribed using protoscript II (NEB) and RT primer oBZ408 (/5Phos/RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTC AGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG) ...
-
bioRxiv - Bioengineering 2019Quote: ... isothermal buffer II (NEB, Ipswich, MA), betaine (Millipore Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 units/ml Dpn II (NEB) in RE buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... ProtoScript II reverse transcriptase from NEB was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... then USER II enzyme (NEB, M5509) was added to cleave the product followed by a second column purification (Zymo research ...
-
bioRxiv - Biochemistry 2023Quote: ... pomatia RNA with Protoscript II (NEB) and random primers ...
-
bioRxiv - Cell Biology 2022Quote: All overexpression constructs with the internally tagged actins were generated by Gibson assembly (New England Biolabs). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR confirmation of endogenously tagged ATR cell lines was performed using NEB Taq DNA polymerase (NEB) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Nextera-tagged primers under standard Phusion or Q5 Polymerase (New England Biolabs). PCR primers used in this study can be found in Supplementary Table 3 ...
-
bioRxiv - Neuroscience 2019Quote: ... pCAV-FLExloxP-Flp was incubated with recombinant Cre recombinase (New England Biolabs) and then transformed into DHα bacteria ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.4 µL (16 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 20 µL ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.75 µL (30 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 30 µL ...
-
bioRxiv - Synthetic Biology 2021Quote: The recombinant CBX8-CD was expressed in BL21 (DE3) (New England Biolabs) Escherichia coli cells ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant Lili-Mips were treated with PNGase F (New England Biolabs) to remove the N-linked oligosaccharides ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were generated using HiFi DNA Assembly Cloning Kit (NEB E5520). During cloning procedures ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were constructed using HiFi DNA Assembly Cloning Kit (NEB E5520). electroporation (device) ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). The enzymes mentioned were purchased from New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Biophysics 2020Quote: mNG-tagged ADRβ2 and EGFR were generating by cloning into the pSNAPf-ADRβ2 backbone (New England Biolabs). mNG was amplified by PCR from mNG-C1 and placed between the EcoRI and SbfI sites of pSNAPf-ADRβ2 (replacing the SNAP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... were reinjected at 75 μl/h and co-flowed with 150 μl/h PCR mix (1.65x NEBNext Ultra II Q5 Master Mix, 0.033 U/μl USER II (NEB), 1.32 M Propylene glycol ...