Labshake search
Citations for New England Biolabs :
251 - 300 of 2342 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 1.25µl of EnGen Cas9 NLS solution (NEB), 1.75 µl H2O ...
-
bioRxiv - Bioengineering 2023Quote: ... 1.4 mM dNTP solution (New England Biolabs), 1.6 μM FIP/BIP ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2024Quote: Purified RNA 3xUCUCU (10 pmol) was first 5’-end dephosphorylated by 5 units of antarctic phosphatase (NEB, 5 U/µL) in antarctic phosphatase buffer (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... ribonucleotides (6 mM ATP, 5 mM CTP, 5 mM GTP; NEB®), 5 mM N1-methylpseudouridine-5’-triphosphate (TriLink® BioTechnologies ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ deadenylase enzyme (NEB) and incubated at RT overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng genomic DNA was either treated with exonuclease V (RecBCD, NEB), in a total volume of 30 ul ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng genomic DNA was either treated with exonuclease V (RecBCD, NEB), in a total volume of 30 μl ...
-
bioRxiv - Genomics 2024Quote: ... Endonuclease V-treated DNA molecules were end-repair with Klenow exo-(NEB), A-tailed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 ng genomic DNA was either treated with exonuclease V (RecBCD, NEB), in a total volume of 30 ul ...
-
bioRxiv - Genetics 2024Quote: ... The Golden Gate product was treated with Exonuclease V (New England Biolabs) at 37°C for 30 min before enzyme inactivation with the addition of EDTA to 11 mM ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gels were sealed in a plastic bag and hybridized at 37 °C overnight with a 5′-(CCCTAA)5−3′ telomeric oligonucleotide probe 5′-end-labeled with T4 polynucleotide kinase (NEB M0201S) and [γ-32P]ATP (PerkinElmer BLU502A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... After signal detection membranes were stripped and re-hybridized overnight at 50 °C with oligonucleotides detecting β-actin (5’-GTGAGGATCTTCATGAGGTAGTCAGTCAGGT-3’) and U6 (5’-GGAACGCTTCACGAATTTGCGT-3’) 5’-end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.4μL 10 mM dNTP Solution (New England Biolabs), 4μL 5x Phusion HF Buffer (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 μM dNTP Solution Mix (New England Biolabs), and a concentration of biotin-11-dNTPs (PerkinElmer ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20μl of extraction solution (25μl of PK (NEB) /ml of NP40 lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: Proteinase solution: 4 μL proteinase K (NEB, P8107S) was added into 1 mL 0.1 M Tris-HCl 0.05 M EDTA (pH 8.0 ...
-
bioRxiv - Biophysics 2023Quote: ... with the following: 3.2 μL solution A (NEB), 1 μL factor mix (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5μl Deoxynucleotide (dNTP) Solution Mix (New England Biolabs), 0.5μl P5 primer pool ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL 1:1,249 diluted Fe2+ solution (NEB), and 8.4 μL water ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl dATP solution 100 mM (NEB; # N0440S), 1 μl BSA (20 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were resuspended in 2X B&W buffer supplemented with 0.4 U/µL RNase Inhibitor (Murine) (NEB, M0314S) to a bead concentration of 5 ug/µL ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatants were discarded and nuclei pellets were washed once with 4 mL Nuclei EZ Lysis Buffer and once with 4 mL of Nuclei Suspension Buffer (NSB) (PBS w/o Mg and Ca; 0.01% BSA; Biolabs ref B9000S ...
-
bioRxiv - Molecular Biology 2021Quote: ... A plasmid encoding Exonuclease V (RecBCD) (New England Biolabs, Inc., Ipswich, MA, USA) was used as a template to amplify recB gene as three overlapping PCR fragments B1 (3080bp) ...
-
bioRxiv - Bioengineering 2024Quote: ... The Endonuclease V-treated products were end repaired with Klenow fragment exo-(NEB), A-tailed (NEB) ...