Labshake search
Citations for New England Biolabs :
251 - 300 of 4455 citations for 5 Cyano 2 3 bis 3 cyanophenyl 2H tetrazolium chloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL USER enzyme (NEB) were added to each sample and incubated at 37°C for 15 min and followed by a purification with 50 µL AMPure XP beads according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 μl USER Enzyme (NEB) was applied to size-selected ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 3 (NEB), 5 μL of α1-2,4,6 fucosidase O (2U/μl ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl 10x NEBuffer2 (NEB), and 18 µl ddH2O ...
-
bioRxiv - Developmental Biology 2024Quote: ... exonuclease and NEBuffer 3 (NEB) were added to the library before incubation at 37 °C for 1 h ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 (New England Biolabs) for multiplexing ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Biophysics 2022Quote: ... The gene sequences were flanked by restriction enzyme sites for 5’ NdeI and 3’ EcoRI (NEB). Genes were cloned into pET21a using standard protocols from NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by dA tailing with 0.25 U/µL Klenow (3′→5′ exo-) (New England Biolabs, M0212) in the presence of 0.5 mM dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was 5’-labelled with 20 U of T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB # M0236S) and 50 pmol of (gamma-32P)ATP (Perkin Elmer ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse: 5’-GCTGCCAGTCCAATAGAGGG-3’) were used with the Luna Universal One-Step RT-qPCR Kit (NEB) with SYBR Green detection on the CFX96 (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single turnover reactions were carried out as follows: 5 µM Clr4 was preincubated 5 minutes with 1 mM final S-adenosyl-methionine (liquid SAM, 3 2mM, NEB #B9003S), and varying concentrations of pSwi6 or unP Swi6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...