Labshake search
Citations for New England Biolabs :
201 - 250 of 4455 citations for 5 Cyano 2 3 bis 3 cyanophenyl 2H tetrazolium chloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5 μl Klenow fragment (3′ to 5′ exo-, Cat. #M0212L; New England Biolabs) and 0.5 μl T4 Polynucleotide Kinase (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gels were sealed in a plastic bag and hybridized at 37 °C overnight with a 5′-(CCCTAA)5−3′ telomeric oligonucleotide probe 5′-end-labeled with T4 polynucleotide kinase (NEB M0201S) and [γ-32P]ATP (PerkinElmer BLU502A) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Developmental Biology 2020Quote: ... act57B sequence: 5’-UCUUCCCCUC-3’ RNA oligonucleotides were end-labeled using T4 Kinase (NEB) with ATP [γ-32P]32 ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was mixed with Klenow Fragment (3′ → 5′ exo−) (NEB, #E6044A) in NEBNext dA-Tailing Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then 3’-end dephosphorylated and 5’-end phosphorylated using T4 polynucleotide kinase (NEB). tRNA library preparation used SuperScript™ IV following the QuantM-tRNA-seq protocol (Pinkard et al ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Genomics 2024Quote: M13seq primer (5’-GACGTTGTAAAACGACGGC-3’) was labeled with 32P at 5’-end by T4 polynucleotide kinase (New England Biolabs). Primer/template (p/t ...
-
bioRxiv - Bioengineering 2024Quote: ... following the manufacturer’s instructions and 3′-O-Me-m7G(5′)ppp(5′)G RNA cap (New England Biolabs, USA) was used as the cap structure analog ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... with subsequent end repair/dA-tailing reaction using Klenow Fragment (3’-5’ exo-) (NEB M0212S) and ligation with Illumina sequencing adapters using T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... The ligation mix (5 μL of LNB, 3 μL of Quick ligase (New England Biolabs), 1.2 μL of MQ ...
-
bioRxiv - Pathology 2021Quote: ... The second strand was synthesized with Klenow Fragments (3′-5′ exo-; New England Biolabs Inc.) and complement chains of NSR primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M) and incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... CrPV 5’UTR-1A-GFP-3’ UTR was generated using Gibson assembly (NEB Gibson assembly). The respective mutants were generated using Site directed mutagenesis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 240 μM TruSeq Universal Adapter (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’) and 0.025 U Taq DNA Polymerase (NEB) in 1X Standard Taq Reaction Buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2.0 units of Klenow Fragment (3’-5’ exo−)(New England Biolabs, Ipswich, Massachusetts, USA), total 10 μl of the mixture was incubate at 37°C for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were 3’ dephosphorylated and 5’ phosphorylated with T4 polynucleotide kinase (T4PNK, NEB, #M0201S), and purified with RNA Clean and Concentrator-5 (Zymo Research ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and second strand cDNA synthesis (using Klenow fragment 3’-5’ exo- [New England BioLabs, USA]) of chicken fecal samples and dust samples was performed as previously described 55 and following manufacturer’ instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μg purified DARPP-32 isoforms as well as 5 μl ATP (New England Biolabs) in kinase dilution buffer III (SignalChem ...
-
bioRxiv - Cell Biology 2022Quote: ... A18-Y260A-SDM-Rev (5’-CGTTGTGTAACCAGGAGAATG-3’) and Q5 site directed mutagenesis kit (NEB E0554). This LT3N1-GPIR-Arhgef18 vectors were further modified to substitute EGFP with 3XHA-FLAG tag ...
-
bioRxiv - Cell Biology 2022Quote: ... miRE-Rv (5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’) and Q5 Hot Start High-Fidelity DNA polymerase (NEB M049S). The final amplicon was then digested and cloned into LT3GEPIR in-between XhoI and EcoRI restriction sites as previously described2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1pmol ssDNA substrate 5’ DY782 ATTATTATTATTATTATTATTTCATTTATTTATTTATTTA-3’ (Eurofins, UK) and 0.75U uracil-DNA glycosylase (NEB) were added to 10µg protein lysate at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Immunology 2024Quote: ... and 0.8U/µL of Klenow Fragment (3’-5’ exo-) DNA polymerase (NEB, Cat No. M0212M). Nickase induced linear SDA was performed using 3nM (0.04U/ µL ...
-
bioRxiv - Biochemistry 2024Quote: ... In short 5’-phosphorylated and 3’-OH RNA was circularized with RNA ligase 1 (NEB) followed by denaturing PAGE purification as described above ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...