Labshake search
Citations for New England Biolabs :
2901 - 2950 of 4208 citations for Huntingtin Interacting Protein 1 Related Protein HIP1R Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... T4 RNA ligase 1 was mixed with splinted RNA in a 1x T4 Rnl buffer (NEB) supplemented with ATP (1 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant SYNJ2BP (0.5 µg) was dephosphorylated using 1 µl of calf intestinal alkaline phosphatase (CIP) (NEB) in 1x CutSmart Buffer in a total volume of 10 µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Biochemistry 2023Quote: The PCR product was purified and 1 µg was phosphorylated using 10 units T4 PNK (NEB) in 20 µl of T4 ligase buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and 1 uL of 10X T4 DNA ligase reaction buffer (New England Biolabs, Cat. No. B0202S) in a final volume of 10 uL ...
-
bioRxiv - Bioengineering 2023Quote: ... we used the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) oligos (NEB E7600S). All sequencing was performed using an Illumina NextSeq 75 cycle high-output kit (Illumina 20024906 ...
-
bioRxiv - Bioengineering 2023Quote: ... the AsCas12a-crRNA complexes were combined with 1 µL of binding buffer (New England BioLabs, #B6002S), 4.5 µL of biotinylated quencher probes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µL PCR Anchor Primer,1 µL Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, Inc., N0447L), 10 µL Q5® Reaction Buffer (New England BioLabs ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of the HMCESSRAP-DNA crosslinking reaction and 0.5 μL of APE1 (New England BioLabs) were added to 8.5 μL final reaction buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Two micrograms of total RNA was circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 and used for the ligation using the Quick Ligation Kit (New England Biolabs). Specific base pair substitutions were introduced with site directed mutagenesis by polymerase chain reaction (PCR) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The fragmented RNA was then circularized with RNA ligase 1 in 20 µl reactions (NEB, M0204S) for 2 hours at 25°C after which the circularized RNA was purified with the Oligo Clean & Concentrator kit (D4061 ...
-
bioRxiv - Systems Biology 2023Quote: ... the flow cell was incubated with Exonuclease I mix (1 U/uL Exo I (NEB, M0293L) in 1x Exo I buffer ...
-
bioRxiv - Genetics 2024Quote: ... then digested with a final concentration of 1 U/μL of DpnII (NEB cat no. R0543S) in 450 μL of 1X digestion reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: Endpoint PCR was performed in a 20 µL reaction volume containing 1× OneTaq Master Mix (NEB), 0.2 µM of each primer and 1 µL of 100-fold diluted cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... or an equivalent mixture of each species was digested with 1 U DpnI (NEB, Ipswitch, MA) for 3 hours at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... A total of 1 μg of cDNA was prepared using the M-MulV reverse transcriptase (NEB) as per vendor instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted 1:10 in PBS-BSA (PBS supplemented with 0.4 mg/mL BSA (New England Biolabs)) ...
-
bioRxiv - Biophysics 2023Quote: ... before staining with SNAP dye buffer (1 µM BG-AF647 (catalog no. S9136S, New England Biolabs) and 1 µM dithiothreitol in 0.5% [w/v] BSA in PBS ...
-
bioRxiv - Immunology 2024Quote: The 200 ng extracted mRNA was digested into nucleosides by Nuclease P1 (1 U, NEB, M0660S) and shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of purified DNA template was used in the Hi-Scribe T7 transcription kit (NEB) at 37°C overnight (∼16 hr.) ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were homogenized in 1x DNA/RNA Protection reagent (New England Biolabs Inc., Part: T2011-1) and RNA was isolated using a commercially available kit (Monarch Total RNA Miniprep Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of total RNA was reverse transcribed using LunaScript RT SuperMix Kit (New England Biolabs) according to the manufacturer’s instructions and 1 µl cDNA was used as a template for a 10 µl qPCR reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... or for 1 h in serum-free DMEM with a cocktail of heparinase I (NEB, P0735S), heparinase II (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl 1 M DTT and 5 µl T4 polynucleotide kinase (NEB, 10 U/µl, #M0201) and incubated at 37 °C for 2 h ...
-
bioRxiv - Microbiology 2020Quote: ... Template DNA was then digested by addition of 20 units (1 μl) DpnI restriction enzyme (NEB: R0176S) and incubation at 37°C for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... RNase III cleavage reactions contained 1 mM DTT and 1.3 U of enzyme (New England Biolabs #M0245S), and were incubated for 6 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this PCR reaction was then combined with 5 μL Q5 buffer (NEB, cat#M0491S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (cat. #E7600, New England Biolabs), and AMPure® XP Beads (cat ...
-
bioRxiv - Microbiology 2021Quote: ... RT was performed using 1 μg of RNA using LunaScript™ RT SuperMix Kit (New England BioLabs) per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequences were indexed using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, NEB #E7600). A series of sequencing runs were performed on Illumina and PacBio platforms ...
-
bioRxiv - Microbiology 2021Quote: ... 60 μL of each fraction was treated with 1 μL of thermolabile proteinase K (New England Biolabs) for 1 h at 37°C followed by inactivation for 10 min at 55°C.
-
bioRxiv - Genomics 2020Quote: ... 1 μg of the blunt-ended DNA was further incubated in 1x T4 DNA ligase buffer (NEB) in 1x T4 DNA ligase buffer (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... crassa strains expressing a Dam fusion was digested with 1 μL of DpnI (NEB, 20 units/μL); ligation to primer 5050 was carried out overnight at 16 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended using 100μL resuspension buffer (10mM Tris pH 7.0, 1% SDS and 0.01U/μL proteinase K (NEB)) for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1μl of a 1:250 dilution of annealed gRNAs was ligated with the T4 DNA Ligase (NEB) into 36ng of the px459 V2.0 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The beads to which GFP-DSB-1 had been immobilized were subject to the phosphatase assay (NEB lambda phosphatase #P0753S ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Genomics 2020Quote: ... 8.5 uL of this phosphorylated product was combined with 1 uL of 10X T4 ligase buffer (NEB) and 0.5 uL of T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... Template DNA was then digested by addition of 20 units (1 μl) DpnI restriction enzyme (NEB: R0176S) and incubation at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 µg RNA was used for each reverse transcriptase reaction using M-MuLV Reverse Transcriptase (NEB) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Five pmol of each standard was dephosphorylated in a 100 μL reaction of 1× CutSmart Buffer (NEB) with 5 units of calf intestinal alkaline phosphatase (CIP ...