Labshake search
Citations for New England Biolabs :
2851 - 2900 of 3658 citations for Diethyl 2 5 diaminoterephthalate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µg of the treated RNA was used for ligation to an RNA oligonucleotide with T4 RNA ligase 1 (NEB M0204) for 1 hr at 25 °C then converted to first strand cDNA with random priming and the ProtoScript II reverse transcriptase mix (NEB E6560) ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Synthetic Biology 2021Quote: SynHox assemblon BACs were verified by digesting a ∼250-500ng purified by alkaline lysis (72) from small scale (5-10 mL) saturated bacterial culture with PvuI-HF (New England Biolabs R3150S). Digestion reactions were carried out at 37°C for 3-24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Neuroscience 2020Quote: ... the 5’-homology arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genomics 2021Quote: ... Purified DNA was subjected to an initial step of PCR amplification consisting of 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) and standard barcoded primers of Nextera kit for each sample ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... PCR work was carried out with primers provided by IDT (Integrated DNA Technologies) (Table 5) and with a proof-reading Q5® High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacture’s guidelines ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Genomics 2020Quote: ... Reverse transcription product was purified using a DNA Clean and Concentrator-5 and used as the template for PCR amplification using i5 and i7 dual indexing primers (NEB #E7600S).
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... and 4.5 μM biotinylated primer oligo IF238 (5/Biosg/TC TCC TCC TTC T) were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75°C for 5 min and cooled to 4°C at a rate of −1°C min−1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Genomics 2022Quote: ... Biotin-labeled DNA fragments captured on beads were ligated to multiplexing adaptors by adding 5 μL each adapter (50 μM) and 1 μL T7 DNA ligase (NEB, M0318L) in 100 μL ligation mixture and incubating at room temperature for 1 hour with rotation ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 region of the 16S rRNA gene was amplified from approximately 5 ng of extracted DNA in 25μl reactions using Q5 HS High-Fidelity polymerase (New England BioLabs, Ipswich, MA) with inline bare primer design as previously described.51 The following V4-specific primers were used ...
-
bioRxiv - Biochemistry 2022Quote: ... the used RNA was radioactively labelled on the 5’-end with [γ-32P]ATP (10 mCi/ml, Hartmann Analytic) and T4 PNK (NEB), following purification via PAGE ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS) at 60°C with primers (Table S3) radiolabeled at their 5’-end using T4 Polynucleotide Kinase (NEB, Cat# M0201S) and γ-32P ATP according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... The samples were run in a 5% native PAGE gel in an ice bath along with low range ssRNA ladder (New England Biolabs, Inc.). The gels were prepared using Acrylamide ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with the oligonu-cleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit (5 μg) user manual (NEB #T1030). Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Biophysics 2021Quote: ... to obtain a 1080 bp long DNA with 5 bp overhang and was subsequently dephosphorylated with Antarctic phosphatase (NEB, catalog #M0289S). The obtained product was PCR purified using Qiagen PCR purification kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Molecular Biology 2022Quote: pGEMHE plasmid constructs (Supplementary Table 2A) were linearized and 5’-capped mRNA was synthesized with T7 polymerase (NEB HiScribeT7 ARCA kit) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All but 5 µl of this product was then diluted 20x into a PCR reaction that consisted of 1x Taq buffer (NEB, B9014), 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products (donor-5’biotin, donor-unmodified) were gel purified using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) and eluted in 20μl embryo transfer water (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Colony PCRs were carried out in 12.0 μL final volumes containing: 5 μL of high-fidelity OneTaq® QuickLoad® 2X Master Mix (New England Biolabs), appropriate forward and reverse control primers (both 0.4 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... chromatin and chromatin bound fractions were released from magnetic beads using binding buffer containing 5 mM CaCl2 plus an excess (2000 units/ 20 mL reaction) of micrococcal nuclease (MNase; NEB, M0247S) Beads were incubated for 5 minutes at 37 °C with shaking (1250 rpm) ...
-
bioRxiv - Biochemistry 2020Quote: Mutagenesis of the 5-HT2C construct was performed according to the Q5® site-Directed Mutagenesis Kit protocol (New England BioLabs). In brief ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The Nested PCR product (5 μl) was digested with NciI restriction enzyme at 37°C for 15 min (New England Biolabs, USA). The final digested DNA fragments was resolved in 2.5 % gel electrophoresis stained with ethidium bromide and visualized with Bio-Rad gel doc XR (Molecular Imager ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37 °C for 1 hour or first with 5 units T4 Polynucleotide Kinase with 25 mM ATP in 1 X T4 Kinase buffer (T4PNK, NEB, M0236S) at 37 °C for 30 min and then with XRN-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were heated to 65°C and slow-cooled to 37°C before reverse transcription with 5 U AMV-RT (NEB, M0277L) at 42°C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Genomics 2022Quote: ... chromatin was digested overnight at 37°C with the addition of 25 μL 10X NEBuffer2 and 100U (5 μL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62°C to inactivate the HindIII ...
-
bioRxiv - Cell Biology 2020Quote: A synthetic miR-409-5p oligo was 5’ end-labelled with γ-P32 ATP using T4 polynucleotide kinase (New England Biolabs) and purified using G-50 columns ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...