Labshake search
Citations for New England Biolabs :
2651 - 2700 of 3658 citations for Diethyl 2 5 diaminoterephthalate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation and dA-tailing by NEBNext FFPE DNA Repair and NEBNext Ultra II End prep modules (New England Biolabs) and purified with AMPure XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 5’ adapter (10 µM) was added and incubated for 5 min at 65°C before addition of T4 ligase buffer (NEB), final 25% PEG8000 and T4 RNA ligase 1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of the library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Then ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of each PCR product was digested with either 0.5 µl XceI/NspI (for Trim28+/D9; Themo Scientific, FD1474) or 0.5 µl MslI (for Tp53R270H/+; New England BioLabs, R0571L) in a final reaction volume of 30 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of each sublibrary plasmid was digested at 37°C for 5 hours with NheI-HF and SacI-HF (New England Biolabs), incubated with rSAP for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB). The resulting fragments were ligated to Nextflex adapters (Bio Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then transferred to a fresh low-bind tube containing pre-washed 5 µl amylose magnetic beads (NEB) and rotated for 45 min at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription was initiated upon addition of 4 nM of dsDNA template (gblocks Gene Fragment, IDT) to a solution of 5 U.μL-1 of T7 RNA polymerase (NEB, M0251), 1 U.μL-1 of murine RNase Inhibitor (NEB M0314) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and containing the sequence DuxblExon 5-iRFP702-Duxbl3’UTR after amplifying the corresponding sequences by PCR followed by Gibson assembly (New England Biolabs) (Supplementary Table 8) ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the beads were resuspended in TEV buffer (final volume 5 mL) with 100 μL TEV protease (New England BioLabs, #P8112S) and incubated at 4°C on a roller overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA (5-10 μg) derived from transfected ESC was digested by high concentrated HindIII-HF or high concentrated BamHI-HF (NEB). In all Southern blot analyses ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... 5’-TTAGAAGAACCGGTCTTCAGTATG-3’ and 5’-CTGTAGGCAAGAAAGCAGAGTATTGTCA-3’) on genomic DNA of pooled or individual embryos followed by digest with XhoI (NEB). Following validation of knock-in ...
-
bioRxiv - Immunology 2022Quote: ... cells were brought to 5×105 cells/ml and incubated with transposition reaction mix (NEBNext High-Fidelity 2X PCR master mix, NEB) for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... Resulting mRNA products were capped with a 5’-Cap 1 structure using vaccinia capping enzyme (New England Biolabs, Ipswitch, MA) and Vaccinia 2’ O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... 5 ng of the synthesized oligo pool were carried out using the Phusion High Fidelity DNA Polymerase (New England Biolabs), with a total of 15 cycles and an annealing temperature of 56 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5′ RNA linkers with four terminal random nucleotides were then ligated to the small RNAs using T4 RNA ligase (NEB) followed by another round of PAGE purification ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Molecular Biology 2022Quote: ... The products were analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel against a 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) and quantitated with a phosphorimager (Typhoon FLA 9500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The thyA gene region was amplified from the genomic DNA (5 ng) with Phusion High-Fidelity PCR Master Mix (New England Biolabs) using 200 nM of thyA forward and reverse primers that give amplicons of 750 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was fragmented at 95°C for 5 min by using a Next Magnesium RNA Fragmentation Module (New England Biolabs), and cleaned up by using a MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel with 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) run in a parallel lane ...
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... primers 5’ caccGGAACAGGCAACATGATTGA 3’ and 5’ aaacTCAATCATGTTGCCTGTTCC 3’ were annealed and golden gate assembled using BpiI (Thermo Fischer) and T4 Ligase (NEB) into s23_U6_scaffoldv2 backbone having BpiI cut sites downstream of U6 promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... each 10 μL of double stranded PCR products were treated with 5 units Lambda exonuclease enzyme (New England Biolabs, NEB) at 37 °C for 45 min which is followed by 10 min at 75 °C for enzyme inactivation.
-
bioRxiv - Molecular Biology 2023Quote: ... each 10 μL of double stranded PCR products were treated with 5 units Lambda exonuclease enzyme (New England Biolabs, NEB) at 37 °C for 45 min which is followed by 10 min at 75 °C for enzyme inactivation.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: Randomly biotinylated DNA templates for TECprobe-ML experiments were PCR amplified from a 5’ biotinylated linear DNA template using Vent (exo-) DNA polymerase (New England Biolabs) and primers HP4_5bio.R and PRA1_NoMod.F (for ZTP and fluoride templates ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... Cells were then spun down at 500 g for 5 minutes and washed with 900 μL of NEBuffer 2.1 (New England Biolabs #B7202). The cells were pelleted (500 g for 5 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... The DNA was digested overnight at 37°C with gentle agitation after adding 25 µl of 10x NEBuffer3 and 5 ul of 25 U/ul MboI (NEB). To biotin end-fill the DNA a 50 ul master mix containing the following was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...