Labshake search
Citations for New England Biolabs :
2801 - 2850 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... the first round of PCR was performed using LongAmp Taq 2X master mix (NEB) and 2 – 3 uL of cDNA (1:5 diluted in water ...
-
bioRxiv - Genetics 2023Quote: ... qRT-PCR was performed using the Luna® Universal qPCR Master Mix (NEB, USA) in a 10 μL total sample volume (5 μL 2× Luna® Universal qPCR Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was performed using Luna Universal qPCR master mix (SYBR green; NEB, USA) on the QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR fragments were generated using Phusion High-Fidelity DNA polymerase (New England Biolabs). The recombinant plasmids were assembled by T4 ligase or Gibson assembly with enzymes/reagents from New England Biolabs (35) ...
-
bioRxiv - Plant Biology 2023Quote: ... The methylated template plasmids remaining in the PCR products were digested by DpnI (NEB), and after transformation to E ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by PCR amplification using Q5 High-Fidelity DNA polymerase (New England Biolabs, #M0491) and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cloning fragments were PCR amplified using Q5 polymerase 2X master mix (New England Biolabs). Full construct sequencing was performed by Plasmidsaurus (Eugene ...
-
MET functions in tumour progression and therapy resistance are repressed by intronic polyadenylationbioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified by 13 cycles of PCR with Phusion polymerase (New England Biolabs). A size selection step was done using Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Bioengineering 2023Quote: ... After a 30 cycles PCR reaction with Q5 hot-start high-fidelity polymerase (NEB) following recommended vendor protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... All missense mutations in PC1 were introduced using PCR amplification and Gibson assembly (NEB) using several unique restriction sites in PC1 ...
-
bioRxiv - Biophysics 2023Quote: ... The backbone and insert fragment were made with Q5 DNA polymerase PCR (M0491, NEB), where the insert PCR fragments were made using primers JT418 (TTAAAATTTATCAAAAAGAGTATTGACTTAA AGTCTAACCTATAGGATACTTACAG ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Backbones were linearized with PCR or with restriction enzymes (NEB, 1h at 37°C). PCR-amplified or digested products were purified (Monarch PCR & DNA Cleanup Kit ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High-Fidelity DNA polymerase from New England Biolabs (NEB). Genes were either synthesized as bacterial codon-optimized gBlocks fragments (IDT ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was performed using Luna® Universal qPCR Master Mix (New England Biolabs) on a Quanta Studio Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biophysics 2023Quote: ... After PCR-amplification using Q5 High-Fidelity 2X Mastermix (#M0492, New England Biolabs Inc.) gel-purified DNA fragments were assembled using RecA recombinase (#M0249 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ELK1 PCR product was digested with the above restriction endonucleases (New England Biolabs) and ligated to the pET17b plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplicons were obtained using the Q5 High-Fidelity Master Mix (New England, BioLabs), 0.4 μM each primer ...
-
bioRxiv - Biophysics 2023Quote: ... DNA fragments were amplified through PCR using Q5® High-Fidelity DNA Polymerase (NEB) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... The variable sgRNA sequences were amplified by nested PCR (Q5 High-Fidelity Polymerase, NEB), the first round of PCR amplifying all sgRNA insertions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and regularly tested for mycoplasma contamination (PCR-based assay from Minerva-Biolabs, Berlin, Germany).
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA inserts were amplified with NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541L). Samples were then pooled in equimolar concentrations ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... and 0.5 µL Phusion High Fidelity DNA polymerase in 1x PCR buffer (NEB #B0518S) in a total volume of 50 μL.
-
bioRxiv - Biochemistry 2023Quote: ... we performed two-step PCR-mediated site-directed mutagenesis using Phusion HF (NEB, M0530) and primers containing the mutation of interest to generate mutant BRCA1 fragments flanked by attL sequences for LR clonase reaction (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments and linearized pDIA6754 were mixed and assembled using Gibson Assembly (NEB, France) and transformed by heat shock in E ...
-
bioRxiv - Immunology 2023Quote: ... CD4 was amplified by PCR using Q5 DNA Hot Start Polymerase (New England BioLabs) in 0.2μM dNTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA fragments were PCR amplified with the Q5U DNA polymerase (New England BioLabs) and then gel purified using the Gel/PCR DNA Fragments Extraction Kit (IBI Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: SPPiDDR1 flanking sequences were amplified by PCR with a high-fidelity Q5 polymerase (NEB) and primers combining recombination attB sites and the extremity of sequence ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∞ at 4 °C) using NEBNext HighFidelty 2x PCR Master Mix (New England Biolabs, M0541S) and Illumina i5 and i7 indices54 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The libraries were amplified using NEB Next High- Fidelity 2X PCR Master Mix (NEB) with primer extension at 72°C for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... and SV40 polyA PCR products were assembled in pattB-w-using Gibson assembly (NEB). Act5C-sfGFP and 3xP3-sfGFP integrations into attP40 were recovered by BestGene ...
-
bioRxiv - Systems Biology 2024Quote: ... These PCR products were used for Gibson assembly with the barcoded promoters (#E2611S; NEB). Gibson assembly reactions were purified with magnetic beads and 2 µl of the reaction were electroporated into 20 µl of electrocompetent e ...
-
bioRxiv - Biochemistry 2024Quote: ... the ecpga gene (GenBank: X04114.1) was amplified by PCR using Q5 polymerase (NEB, USA) from our previous plasmid pKA1868 with ecPGA cloning primers bearing NdeI and XhoI site overlaps ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The PCRs were run with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products (pICOt and pICOt2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Both PCR and qPCR were performed using Pfusion High-Fidelity Polymerase Master Mix (NEB) and full-length Solexa P3/5 primers ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5μl of the PCR product was mixed with 6x loading buffer (New England BioLabs) and electrophoresed on a 1.5% TAE agarose gel for F1534C and V410L ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR was carried out using the Q5 high-fidelity DNA polymerase (New England Biolabs), the 5’ phosphorylated primer pairs and their corresponding annealing temperatures (Ta) ...
-
bioRxiv - Molecular Biology 2024Quote: The point and deletion mutants of SMG8 were PCR amplified using Q5 polymerase (NEB) and inserted with an N-terminal FLAG-tag via NheI and NotI restriction sites into the tetracycline-inducible pcDNA5/FRT/TO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR amplification was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) for 35 cycles with a 20-second extension time ...
-
bioRxiv - Cancer Biology 2024Quote: Quantitative RT-PCR was done with the Luna Universal qPCR Master Mix (#M3003, NEB,) using a QuantStudio 5 Real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: ... transposed DNA was mixed with NEBNext high-Fidelity 2x PCR Master Mix (NEB, #M0541S), AD1_noMX and AD2.1-2.16 barcoded primers ...
-
bioRxiv - Biophysics 2024Quote: ... PCR was performed using Q5 HotStart high fidelity master mix (New England Biolabs #M0494S). Following KLD enzyme treatment (NEB #M0554S) ...
-
bioRxiv - Bioengineering 2024Quote: Polymerase chain reaction (PCR) of constructs utilized for plasmid assembly were amplified by NEB Q5 Hot-Start 2X Mastermix according to the manufacturer’s protocol (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... ▴CRITICAL For PCR amplification we use the Q5® High-Fidelity DNA Polymerase (NEB) but other can be picked such as Phusion ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-tagged GATE16 was generated via Q5 site-directed mutagenesis PCR (New England Biolabs), replacing the GST tag with the sequence MHHHHHHGS ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction was set up using Q5 polymerase (New England Biolabs, Whitby, Canada) following the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2024Quote: ... after PCR amplification from Bacteroides fragilis ATCC 25285 (NCTC 9343) genomic DNA by NEB HiFi DNA assembly (Gibson Assembly) ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product and Plasmid were subjected to restriction digestion by using Xho1 (NEB) and Hind III (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...