Labshake search
Citations for New England Biolabs :
2751 - 2800 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: All PCR reactions were done in 50𝜇l volume using Q5 high fidelity polymerase (NEB) following NEB Q5 high fidelity PCR protocol ...
-
bioRxiv - Genomics 2024Quote: ... Two 50 μl PCR reactions were performed per sample with Q5 Polymerase (NEB M0492S) with real-time tracking using SYBR green dye with the following cycling parameters 98°C - 3 min ...
-
bioRxiv - Genomics 2024Quote: ... Four 50 ÎĽl PCR reactions were performed per sample with Q5 Polymerase (NEB M0492S) with the following cycling parameters ...
-
bioRxiv - Bioengineering 2024Quote: Constructs were cloned by PCR methods using Q5 High-Fidelity Polymerase (New England Biolabs) and fragments were assembled by Gibson assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR reactions were performed using Q5 High-Fidelity DNA polymerase (New England Biolabs, USA) and purified using DNA Clean and Concentrator 5 kit (Zymo) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 µL PCR reagents containing 1.67X Q5® High-Fidelity Master Mix (NEB, M0515), 0.625 mg/mL BSA ...
-
bioRxiv - Immunology 2023Quote: ... the scFv insert from isolated plasmids was amplified by PCR using Q5 polymerase (NEB). DNA samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2023Quote: PCR amplification was performed using Q5 high fidelity polymerase (New England Biolabs, Hitchin, UK) and PCR screening was performed using GoTaq Flexi DNA polymerase (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: CloneAmp HiFi PCR Premix (TakaraBio) and Phusion High-Fidelity DNA polymerase (New England BioLabs) were used for PCR reactions for all plasmid constructions ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing adapters were then added with two rounds of PCR with Q5 (NEB #M0492) (GWLP P4-7) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and mutated by PCR to generate the disease variant alleles (New England Biolabs #E0554S). The utilized mutagenic primers are as follows ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA fragments were amplified by PCR (Q5 2x Master Mix, New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using the Quick-LoadR©Taq2×Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Fragments were isolated by PCR amplification using Phusion® High-Fidelity DNA Polymerase (NEB) from Col-0 genomic DNA/cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were sequentially digested with the appropriate restriction endonuclease (New England Biolabs) and re-purified ...
-
bioRxiv - Cell Biology 2023Quote: ... all PCRs were performed using Q5 High Fidelity DNA polymerase (M0419; New England Biolabs). A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Backbones were linearized with PCR or with restriction enzymes (NEB, 1h at 37°C). PCR-amplified or digested products were purified (Monarch PCR & DNA Cleanup Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed using Phusion 5X Master mix (New England Biolabs GmbH, M0492S). For a 25 µl reaction ...
-
bioRxiv - Biophysics 2023Quote: ... The backbone and insert fragment were made with Q5 DNA polymerase PCR (M0491, NEB), where the insert PCR fragments were made using primers JT418 (TTAAAATTTATCAAAAAGAGTATTGACTTAA AGTCTAACCTATAGGATACTTACAG ...
-
bioRxiv - Immunology 2023Quote: ... PCR was then performed on genomic DNA with relevant primer pair and enzyme (NEB) (see materials and methods chapter for PCR programme) ...
-
bioRxiv - Biophysics 2023Quote: ... After PCR-amplification using Q5 High-Fidelity 2X Mastermix (#M0492, New England Biolabs Inc.) gel-purified DNA fragments were assembled using RecA recombinase (#M0249 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ELK1 PCR product was digested with the above restriction endonucleases (New England Biolabs) and ligated to the pET17b plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High-Fidelity DNA polymerase from New England Biolabs (NEB). Genes were either synthesized as bacterial codon-optimized gBlocks fragments (IDT ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was performed using Luna® Universal qPCR Master Mix (New England Biolabs) on a Quanta Studio Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... in vitro transcription templates were generated by PCR using Q5 polymerase (New England Biolabs) and primers listed in (Extended Data Table 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Neuroscience 2023Quote: ... Cloning PCRs were performed using Phusion High Fidelity DNA polymerase (M0530L, New England BioLabs) and then validated by Sanger sequencing ...
-
bioRxiv - Physiology 2023Quote: ... All PCR was achieved using Hot Start Taq DNA Polymerase (New England BioLabs, Inc) under the following settings ...
-
bioRxiv - Genomics 2023Quote: ... The in/out PCRs were carried out with Q5 polymerase (New England BioLabs, M0494S), while the out/out PCRs were carried out with PrimeSTAR GXL DNA Polymerase (Takara Bio ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All PCR amplifications for plasmid construction were performed using Q5 High-Fidelity Polymerase (NEB). All plasmids were sequence verified through Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments were gel-purified and incubated with HiFi DNA assembly enzyme mix (NEB) and transfected into E ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was PCR-amplified using Q5 High-Fidelity 2x Master Mix (NEB M0492) for 20 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... The enrichment PCR master mixture contained 2,200 OneTaq 2X Master Mix (New England Biolabs), 16.5 uL synHEK3 P7 enrichment primer (100 uM) ...
-
bioRxiv - Biophysics 2023Quote: ... purified cDNA was used as a template for PCR using Q5 DNA Polymerase (NEB) and forward and reverse sequencing primers (Table S2) ...
-
bioRxiv - Immunology 2023Quote: ... tagmented DNA was amplified using NEBNext High-Fidelity PCR Master Mix (New England BioLabs) with the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA fragments were PCR amplified with the Q5U DNA polymerase (New England BioLabs) and then gel purified using the Gel/PCR DNA Fragments Extraction Kit (IBI Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... After a 30 cycles PCR reaction with Q5 hot-start high-fidelity polymerase (NEB) following recommended vendor protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 ÎĽL PCR reactions were set-up using 2 ÎĽL 5x HF Buffer (NEB), 0.5 ÎĽL 10 mM dNTPs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCRs were performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... the PCR products were then inserted into the opened vector with NEBuilder (NEB, #E5520). Six copies of the MLANA-specific gRNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs catalog # M0531), and/or LongAmp® Hot Start Taq DNA Polymerase with Expand HF Buffer (Roche catalog # 05917131103 ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified using NEBNext HiFi 2X PCR Master mix (NEB cat. no. M0541) with 13 rounds of amplification as described previously28 ...
-
bioRxiv - Genomics 2022Quote: ... 25 ÎĽl of NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S), 2.5 ÎĽL each of Nextera i5 and i7 indexed amplification primers (Nextera Index Kit ...
-
bioRxiv - Genetics 2022Quote: ... blunt-end PCR products were generated using Phusion High Fidelity DNA Polymerase (NEB M0530S) and forward primers were designed including 5’-CACC-3’ on the 5’ end for directional cloning and then ligated into MultiSite Gateway™-compatible pME entry vectors using pENTR/D-TOPO (Invitrogen K240020) ...
-
bioRxiv - Genetics 2023Quote: ... 5% DMSO and 1× NEBNext High-Fidelity PCR master mix (New England BioLabs, M0541L) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The desired inserts were amplified by PCR using Q5 high-fidelity DNA polymerase (NEB) with the high-GC buffer as per the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... and for colony PCRs the OneTaq Quick-Load Master Mix Polymerase was used (NEB). PCR products were analyzed on 1 % TAE agarose gels ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplifications were set up using the Q5 protocol (New England BioLabs, MA, USA), with the previously described plasmid (pEE392 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 385 bp PCR product was digested with 1 unit of Hpy188III (NEB #R0622) for 2 hrs at 37°C ...