Labshake search
Citations for New England Biolabs :
2701 - 2750 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... the collected cell pellets were processed using Monarch RNA extraction kit (New England BioLabs). The RNA samples were then quantified with nanodrop and normalized before cDNA synthesis (Lambda Biotechnologies) ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, E2040S), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NEB Next® Ultra RNA Library Prep Kit for Illumina (E7530L, NEB, USA) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA libraries were prepared using NEB UltraII RNA library Prep kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was depleted of rRNA using the Illumina rRNA Depletion Kit (NEB #E6310) and then prepared for Illumina sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina #E7760 per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Small RNA libraries were prepared using the NEBNext Small RNA Library Prep kit (NEB), with some modifications ...
-
bioRxiv - Systems Biology 2023Quote: ... rRNA depletion was performed with the NEBNext rRNA Depletion Kit v2 (New England Biolabs), and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) as described by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... The transcribed mRNA was purified using Monarch RNA Cleanup Kits (NEB, Cat. No. T2040L) and kept in - 20 until further use.
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA immunoprecipitations and inputs were converted to cDNA using LunaScript RT SuperMix Kit (NEB). m6A-immunoprecipitated samples were normalised to their respective input samples and m6A content at a particular region calculated relative to an unmodified control region within the same transcript.
-
bioRxiv - Genetics 2023Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The domain swap constructs were assembled using the NEBuilder HiFi DNA assembly kit (NEB). Briefly ...
-
bioRxiv - Microbiology 2022Quote: We introduced single point mutants using the Q5® Site-Directed Mutagenesis kit (NEB). Primers containing the mutation amplified the entire CIp10–GPR1–mTurquoise2 plasmid and were confirmed through sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabsⓇ Inc., MA, USA) was preferred in order to select aggregation inhibitory peptide selection ...
-
bioRxiv - Microbiology 2023Quote: ... USA] or the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Plasmid assembly was conducted using NEBuilder HiFi DNA Assembly cloning kit (NEB, cat # E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length PCR product was purified using Monarch Gel Extraction Kit (NEB #T1020), according to manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg RNA was reverse transcribed to cDNA using LunaScript RT SuperMix Kit (NEB). qPCR was performed in 20 μl reactions containing diluted cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... First-strand cDNA was generated using ProtoScript first strand cDNA synthesis kit (NEB, E6300S) with oligo-dT primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... where ribodepletion was performed using the NEBNext rRNA Depletion Kit (New England BioLabs, E6310). Paired-end 75 base pair (bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... where ribodepletion was performed using the NEBNext rRNA Depletion Kit (New England BioLabs, E6310). Single-end 75 base pair reads were sequenced using the NextSeq 500 (Illumina).
-
bioRxiv - Biochemistry 2022Quote: ... using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Molecular Biology 2023Quote: ... 50 μg tissue for each sample using the Total RNA isolation kit (#T2010, NEB) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Utilizing the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The product was purified with a Monarch PCR and DNA cleanup kit (NEB, T1030) and restricted with enzymes Nde1 (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760S, New England Biolabs) was used to prepare the sequencing libraries ...
-
bioRxiv - Genetics 2023Quote: ... Cloning was conducted using the NEBuilder HiFi DNA Assembly cloning kit (NEB, no. E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... ChIP libraries were prepared by NEBNext ultra II DNA library preparation kit (NEB E7645L) and sequenced on one lane of a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: Cells were lysed and RNA extracted using the Monarch Total RNA Miniprep Kit (NEB) or RNA cleanup kit (NEB ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA was synthesized using NEB’s HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For generation of transgenic fish ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were inserted into this vector using the Gibson Assembly Cloning Kit (New England BioLabs). The final constructs were linearized using the KpnI restriction enzyme (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... the DNA was extracted by using Monarch® Genomic DNA Purification Kit (NEB, T3010S). For the analysis of microdeletions of the targeted exons an Out-Fwd (p1 GCACAGTCAGACCACAGTCACC ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using NEB Next Ultra DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... ∼100 ng of RNA was treated with NEBNext rRNA Depletion Kit (New England Biolabs). RNA-Seq was performed using libraries prepared with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB, E7645S), and sequenced for 50-nt SE reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB), Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB) and ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (E7546S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of IVT mRNA was conducted using the Monarch RNA Cleanup Kit (NEB #T2040L). To confirm IVT mRNA were of the correct lengths ...
-
bioRxiv - Biochemistry 2023Quote: ... or the Monarch RNA Cleanup Kit (500 μg) (New England BioLabs, cat. no. T2050L). Samples were eluted in a nuclease-free duplex annealing buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA targets were purified with Monarch® RNA Cleanup Kit (T2040L, New England BioLabs).
-
A laboratory framework for ongoing optimisation of amplification based genomic surveillance programsbioRxiv - Genomics 2023Quote: ... cDNA was generated for all samples using LunaScript RT SuperMix Kit (New England BioLabs). Sufficient volume was prepared to perform serial dilutions (10−2 to 10 -7 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7490S and #E7760S) was used to construct sequencing libraries following the manufacturer’s guidelines with one alteration ...
-
bioRxiv - Plant Biology 2023Quote: ... The Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Cat # E3005X) and reaction protocol (cycle variations ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using either Monarch Total RNA Miniprep Kit (New England Biolabs) or Direct-zol™ RNA MiniPrep kit (Zymo Research ...