Labshake search
Citations for New England Biolabs :
2601 - 2650 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Plant Biology 2023Quote: ... 7 µg (DNA mass) of NCPs (with 188bp NPS) or free DNA was incubated with 5 Kunitz units of MNase (NEB M0247) in a reaction buffer (30 mM Tris pH 8.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were treated with 5′ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3′ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... oligonucleotide X12-3 HJ3 (93 nt) was labeled at the 5’ terminus with [γ-32P] (Hartmann-Analytic) and T4 polynucleotide kinase (New England Biolabs), according to standard protocols65 ...
-
bioRxiv - Neuroscience 2023Quote: ... The mRNA was fragmented using divalent cations under 94°C for 5-7min using the NEBNextTM Magnesium RNA Fragmentation Module (New England Biolabs, #E6150S). RNA fragments were reverse-transcribed using SuperScriptTM II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid CassetteAv2_pBAD contains the CRISPR03 array cloned into the pBAD/Myc–His B backbone (Life Technologies).12 It was used to prepare CRISPR DNA substrates by PCR with primers MMB1Lead40-5 and MMB1crisp3-r1 using Phusion High-Fidelity DNA polymerase according to the manufacturer’s protocol (New England Biolabs or ThermoFisher). The resulting 88-bp PCR product has a 40-bp leader ...
-
bioRxiv - Molecular Biology 2023Quote: ... The fragmented RNA was then subjected to a 5’ dephosphorylation reaction at 37°C for 30min by adding rSAP (NEB, M0371L) and PNK enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Initial PCR amplifications were carried out in a 30 μl mixture that included 5 μl of KAPA HiFi Fidelity Buffer (New England Biolabs, UK), 0.3 μM of forward and reverse primers ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the annealed substrates was 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (New England Biolabs). For fluorescently labeled HJ40 substrates ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Double-stranded oligonucleotides corresponding to synthetic enhancers with gibson arms were synthesized by IDT (GeneBlock) and assembled into targeting vector using 5 μl of NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S), 36 ng of linearized vector ...
-
bioRxiv - Biochemistry 2023Quote: ... The total RNA was treated by DNase I (5 U per 100 μg total RNA) and mRNAs were enriched by NEBNext Poly(A) mRNA magnetic isolation module (NEB E7490L). 8-10 μg of mRNA from each sample was fragmented to the size of ~120-nt by Ambion Fragmentation reagent (Thermo Scientific AM8740 ...
-
bioRxiv - Genetics 2023Quote: ... Samples were then incubated in 30°C water bath for 5 hours with 50 μL of RCA mixture that contained 250 μM dNTP (New England Biolabs, N0447L), 1 mM extra-supplemented DTT ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Multiplex-polymerase chain reaction (PCR) was performed in two separate reaction mixes prepared by combining 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), 0.5 μl of 10 mM dNTPs (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... was modified with a guide RNA (GTCGGACGCGAAACTCGCTT) to target the 5’ region of the ROP33 gene (sgROP33) using Q5 mutagenesis (New England Biolabs, MA). Then a CRISPR/Cas9 replacement construct was created using Gibson assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ termini of all ten DNA fragments (F1-F9 and the linker) were phosphorylated by using T4 PNK (NEB; #M0201), and the equimolar amounts (0.05 pmol each ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting full-length cDNA was gel-purified and ligated to the 5′ adaptor OWG920 with High Concentration T4 RNA Ligase (NEB M0437M) overnight on a shaking thermomixer ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µl of 100 µM barcode-linked oligo-dT primer was added to each well with 5 µl of 5x ProtoScript RT buffer (New England Biolabs M0368). The plate was incubated at 94°C for 2 min and immediately cooled on ice for at least 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were constructed using the NEBNext Ultra II directional RNA library preparation kit for Illumina according to the protocol for purified mRNA or ribosome-depleted RNA and with a 5-min RNA fragmentation step (NEB E7760). Library PCRs were supplemented with 2× SYBR dye (Sigma S9430 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... Prior to library preparation a UDG-treatment was performed using 16.25ul of purified DNA and 5 μl (1U/1uL) USER enzyme (New England BioLabs®, Inc.) and an incubation of 3 hours at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Zoology 2024Quote: ... The annealed dsRNAs (2.5 µg) were checked on 1.5% agarose gel by running them together with 2 µL of dsRNA ladder (NEB# N0363S, Germany) (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Biophysics 2024Quote: ... A 691 bp biotinylated DNA handle with a 29 nt 5′ overhang was amplified by Q5 DNA polymerase (NEB, Cat# M0491S) using a 5′ biotinylated forward primer and a reverse primer containing an abasic site 43 ...