Labshake search
Citations for New England Biolabs :
2501 - 2550 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... spin purified with DNA clean and concentrate kit (NEB), and sequenced with Plasmidsaurus.
-
bioRxiv - Molecular Biology 2024Quote: The Q5 Site-Directed Mutagenesis Kit (New England Biolabs) was used to introduce the mutations into pET15b plasmid-borne copies of PRX1 and TRX3 genes using pairs of adequate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Monarch® RNA Cleanup Kit (New England Biolabs) was used to purify transcribed RNA strands ...
-
bioRxiv - Microbiology 2024Quote: ... the NEBNext Ultra II DNA Library Prep Kit (NEB) was used according to the manufactu er’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... a Quickchange site-directed mutagenesis kit (New England Biolabs) was used to introduce the F405L and K409R mutations in the HC plasmids of the IgGs to make the bsAbs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genetics 2021Quote: ... Custom inverse complementary adapters that had inverse complementary terminal modifications to ensure unidirectional ligation (3’-T overhang and 5’ phosphorylation) were ligated onto both ends of the respective subsets using the Ultra II Ligation Module (NEB, USA) according to manufacturer’s instructions and purified with 1:1 bead cleanup (Figure 3) ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µg of the treated RNA was used for ligation to an RNA oligonucleotide with T4 RNA ligase 1 (NEB M0204) for 1 hr at 25 °C then converted to first strand cDNA with random priming and the ProtoScript II reverse transcriptase mix (NEB E6560) ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Synthetic Biology 2021Quote: SynHox assemblon BACs were verified by digesting a ∼250-500ng purified by alkaline lysis (72) from small scale (5-10 mL) saturated bacterial culture with PvuI-HF (New England Biolabs R3150S). Digestion reactions were carried out at 37°C for 3-24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the 5’-homology arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genomics 2021Quote: ... Purified DNA was subjected to an initial step of PCR amplification consisting of 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) and standard barcoded primers of Nextera kit for each sample ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... PCR work was carried out with primers provided by IDT (Integrated DNA Technologies) (Table 5) and with a proof-reading Q5® High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacture’s guidelines ...
-
bioRxiv - Genomics 2020Quote: ... Reverse transcription product was purified using a DNA Clean and Concentrator-5 and used as the template for PCR amplification using i5 and i7 dual indexing primers (NEB #E7600S).