Labshake search
Citations for New England Biolabs :
2601 - 2650 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: 2 μl of genomic DNA was used to amplify strain barcodes by PCR (Q5 NEB master mix, 22 cycles) using primers containing sequence-optimized spacers to maximize nucleotide diversity in Illumina sequencing ...
-
bioRxiv - Systems Biology 2020Quote: ... We discarded the supernatant and resuspended the pellet in 2 mL of 1x NEB buffer 3.1 (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pellet was dissolved and digested in 50 ml buffer A with 2 mM CaCl2 and 4,000 units of micrococcal nuclease (M0247S, NEB) at RT for 20 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 ul of cDNA without dilution was used for each PCR reaction by Phusion® HighFidelity DNA Polymerase (NEB) for 35 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 μg of supercoiled plasmid DNA was incubated at 37 °C for 3 hours with purified SpRY protein at a final concentration of 1 μM and IVT gRNA (prepared without DNase treatment) at a final concentration of 2 μM in Buffer 3.1 (NEB). Reactions were stopped by the addition of 1 μL of Proteinase K (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 37°C and purified using Monarch® DNA Gel Extraction Kit (T1020S, New England Biolabs) before digestion-ligation with the gRNA-pScaffold-H1 using FastDigest Esp3I and T7 Ligase (M0318L ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by addition of 2 μl of no SDS-purple gel loading dye (New England BioLabs) or 50% glycerol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2021Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at −20 °C ...
-
bioRxiv - Genetics 2021Quote: ... Cells were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in −20°C in 70% EtOH until further use.
-
bioRxiv - Genetics 2021Quote: ... We added 1 µL 12.5% Triton-X to each well to quench the SDS and 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Biochemistry 2021Quote: ... Heparinase digests were performed for 2 hours at 37 °C with a mixture of Heparinase I + II and III (3.5 mUnits/ml, NEB) in Heparinase digestion buffer (20 mM Tris ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA libraries for Illumina sequencing were prepared with the NEBNext Ultra 2 DNA Library Kit for Illumina (NEB, E7645L) using 200ng of DNA and custom made unique dual indices (8bp) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were A-tailed by incubating 750 ng of DNA with 2 Units of Taq DNA Polymerase (NEB) and 0.2 mM dATP (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... without codon optimization and was inserted into pcDNA 3.1 to g et pcDNA 3.1-SARS-CoV-2-Spike using NEBuilder® HiFi DNA Assembly Master Mix (NEB) a ccording to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: The furin cleavage specificity was assayed by incubating 2.5 μg (7.6 μM) S1/S2-GB1-6xHis substrate with 2 U furin (New England Biolabs, p8077) in 30 μl reactions ...
-
bioRxiv - Genetics 2022Quote: ... Embryos were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 4 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in 70% EtOH in −20°C no longer than 1 day before further processing.
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV transfer vectors used for 3-plex sgRNA delivery into skeletal muscle were cloned between AAV serotype 2 ITR’s including a cloning site for multiplexed hU6-sgRNA insertions (MluI and KpnI (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... Conventional PCR assays were carried out with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Australia). For some samples ...
-
bioRxiv - Plant Biology 2022Quote: ... we first created a RUBY-minus vector lacking the gene GT by assembling PCR product 1 containing CYP76AD1 and DODA and PCR product 2 containing Arabidopsis HSP18.2 terminator into a pGFPGUSplus vector 18 via NEBuilder HiFi DNA Assembly (New England BioLabs). The pAXY0006 vector of split-RUBY was generated by assembling PCR products containing f1 fragment of gene GT (named GTf1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μL i7 unique index primer (10 μM) and 25 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB) were added to 21 μl of purified CUT&TAG DNA ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.6 µL of 10X GlycoBuffer 2 (Cat.#B3704S; New England Biolabs), 2.6 µL of 10% NP-40 (Cat.#B2704S ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate, NEB Ipswich MA) or ΦX174 RF I DNA (dsDNA substrate ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1X-PBS, 0.5% Triton X-100, 2 mM vanadyl-ribonucleoside complex (New England Biolabs)) for 4 min on ice ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genetics 2023Quote: ... The PCR reaction was performed using NEBNext® High-Fidelity 2× PCR Master Mix (New England BioLabs, catalog #M0541) with a reaction volume of 10 ul including 5 ul 2× PCR Master Mix ...
-
bioRxiv - Biophysics 2023Quote: ... and DNA-bound proteins were released by MNase treatment (2 min 30° with 700 units of MNase NEB # M0247S) and analyzed by gel electrophoresis40.
-
bioRxiv - Molecular Biology 2023Quote: ... Homology fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621), while guide RNAs were inserted by ligation using T4 ligase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... We digested the cosmid-i95 for 2 h at 37°C using SpeI-HF restriction enzyme (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Genomics 2023Quote: ... or 40,000 nuclei per well in 22 µL of NSB and 2 µL of 10 mM dNTP mix (NEB).
-
bioRxiv - Evolutionary Biology 2023Quote: ... All mutants (Arp2D subdomain 2 swap, Arp2D-2CT, and Arp2-2DCT) were generated using Q5 site-directed mutagenesis (NEB). All genes were cloned into a vector encoding an attB site and superfolder GFP under the control of an eye-specific promoter (3XP3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...