Labshake search
Citations for New England Biolabs :
2501 - 2550 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... PURExpress D Ribosome Kit (NEB #E3313S) and New England Biolabs PURExpress In Vitro Protein Synthesis Kit (NEB #E6800) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1pmol of each fragment were then assembled for 1h at 50°C using NEBuilder HiFi DNA Assembly master mix from the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, ref E5520S). Reaction products were amplified in provided bacteria and purified using QIAprep Spin Miniprep Kit.
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Cell Biology 2020Quote: ... MNase (non-specific DNA digestion) used MNase buffer and 2 μL of enzyme (20 units/μL) PvuII (NEB), AluI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... After digestion the plasmid vector and insert were added to Gibson assembly master mix (1.5 µl insert, 0.5 µl vector, 2 µl master mix) (New England BioLabs) and incubated at 50 °C for 1 hr ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were pre-treated with 0.5 mM ATP and 2.5 U casein kinase 2 (CK2) in 1X CK2 buffer (NEB) for 15 min at 30°C ...
-
bioRxiv - Immunology 2022Quote: T7 endonuclease I digestion: 200 ng of purified DNA amplicons were annealed with 1X NEBuffer 2 (NEB, # B7002S) and total volume was brought up to 19 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of 2 mM dNTP and 0.5 μL (2.5 U) of DNA polymerase I Klenow fragment (New England Biolabs) were added to the reaction mixture ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... and an additional hour after the addition of 2 U/ 50 µl of DNase (New England Biolabs, Inc.). The RNA samples were purified using an 8% Acrylamide:Bis-Acrylamide (29:1 ...
-
bioRxiv - Molecular Biology 2020Quote: Biotinylated DNA pellets were re suspended in 25μl TNE0.2 buffer (200mM NaCl, 10mMTris-HCl 7.5, 1mM EDTA) and mixed with 25μl Streptavidin coated magnetic beads (NEB, pre washed in TNE0.2 and blocked with 100μg/ml salmon sperm DNA) ...
-
bioRxiv - Neuroscience 2020Quote: ... A cDNA amplification mixture was prepared by adding 5µl of the resulting first strand cDNA with 7.5µl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5µl water ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each sample was first treated with DNase I (New England Biolabs; 2 μL and 25μL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular plasmid DNA ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were then stopped by 2 μl of no SDS-purple gel loading dye (New England BioLabs) and separated on 0.6% agarose gel at 100V for 50 min in 1XTBE ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human recombinant histone H2A/H2B dimer (1.5 μg, 54 pmol) and histone (H3/H4)2 tetramer (1.5 μg, 27 pmol) (New England BioLabs) were mixed with the linearised 601 DNA fragments (6 μg ...
-
bioRxiv - Genetics 2020Quote: ... and multiplex barcoded with NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 2) (NEB, Ipswich, USA). An Illumina MiSeq device (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2) using Q5 polymerase (NEB) and genomic DNA templates obtained from the Liebniz Institute [dsmz.de] ...
-
bioRxiv - Microbiology 2020Quote: The RNA was ligated to 10.7 pmol barcode DNA linker using 200 U T4 RNA ligase 2 (NEB) overnight at 16 °C ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids (Supplementary Table T 2) were cloned by isothermal assembly using NEBuilder HiFi DNA Assembly Mix (NEB). Plasmids were transformed into E ...
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The resulting plasmid will be referred to as pBd-phoD-HA-BSD.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The homology and guide RNA were inserted as described for pBdEF-Cas9-BSD-phodR ...
-
bioRxiv - Genomics 2023Quote: ... with the inserts at 2 fold molar excess followed by multiple transformations into NEB stable competent E.Coli (NEB) to ensure at least 20x coverage of colonies for every sgRNA ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 7,500 cells were diluted with 1.25 ml of a dilution buffer containing 0.4x NEBuffer 2 (NEB, B7002S), 2 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The reaction was incubated at 37°C overnight and stopped by adding 2 Units of DNase I (NEB) and incubating at 37°C for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was mixed with 2 µL of random primer mix (New England Biolabs, UK) in RNase free PCR strips (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...