Labshake search
Citations for New England Biolabs :
2551 - 2600 of 7435 citations for rno mir 206 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... the ‘T2A-GFP-WPRE’ sequence was amplified from the hVMD2-hBEST1-T2A-GFP plasmid using LCv2-GFP.Gib.F and .R primers and Q5 2X MM (NEB, Cat# M0492L). The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB ...
-
bioRxiv - Genetics 2019Quote: ... was amplified with KAPA polymerase using primers #545 and #546 (Table S5) and purified with Monarch DNA Cleanup Columns (NEB). Both intermediate construct and amplified gBlock were digested with BbsI (NEB ...
-
bioRxiv - Genetics 2019Quote: ... encoding a scaffold and the mouse U6 promoter was amplified with KAPA polymerase using primers #545/#546 (Table S5) and purified with Monarch DNA Cleanup Columns (NEB). Both intermediate library and amplified gBlock were digested with BbsI (NEB ...
-
bioRxiv - Genetics 2020Quote: ... An 18-mer poly-N barcode was created by annealing primers (Table S1) and extended to make fully double stranded with Klenow polymerase (NEB). The barcode was then PCR purified (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... treatment on the total RNA was performed and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The cRFXa CDS was amplified from cDNA using primers MC252 and MC253 and Q5 DNA polymerase (NEB Cat. No. M0491L), with 2 µl of cDNA template in a 50 µl PCR reaction and 35x cycles ...
-
bioRxiv - Plant Biology 2022Quote: ... Each fragment was PCR amplified using the primers listed in Supplementary Table 1 and was cloned into the pCAMBIA1300 using the T4 DNA ligase (NEB). The construct was transformed into the atalkbh9b-1 mutant and the transgenic lines were identified for homozygosity at T3 generation.
-
bioRxiv - Synthetic Biology 2022Quote: The detection in the specific primer amplification experiments was performed with a lower concentration of LbCas12a (1μM, NEB, Cat. # M0653S). Interestingly ...
-
bioRxiv - Microbiology 2022Quote: ... and an equimolar mix of primers P5-IR2a-d primer (10 µM) in a reaction with 50 ng of adaptor ligated template and Phusion DNA polymerase (NEB) in a thermocycler with the following program 98°C 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... The library of circular DNA fragments was then used as a PCR template with forward and reverse primers specific to the transposable element and amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs). PCR products were separated by electrophoresis on a 1% agarose gel and purified using the Zymoclean Gel DNA recovery Kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: ... Vector pET16b and gene mksB (cg3103) were amplified using primer pair MG093/MG094 and MG095/MG096 respectively and cloned using the Gibson Assembly Mastermix (NEB), resulting in plasmid pMG004 ...
-
bioRxiv - Systems Biology 2022Quote: ... The sgRNA oligo pool with restriction sites and flanking primer sequences was synthesized by Twist Bioscience and was amplified using Q5 polymerase (NEB). The PCR reaction was carried out as following ...
-
bioRxiv - Plant Biology 2022Quote: ... For quantitative PCR 90 ng of template DNA was used in 10 μl qPCR reactions with 0.25 μM primers and Luna qPCR Master Mix (NEB, USA). qPCR was performed in a LightCycler 480 (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with primers 515F–806R targeting the V4 region of the 16S rRNA using Phusion High-Fidelity DNA Polymerase (NEB). The PCR product concentration was measured with Quant-iT PicoGreen dsDNA Assay Kits (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... On-bead PCR indexing-amplification was performed using custom-ordered indexing primers (IDT) matching the Illumina Nextera Index Kit sequences and 2x Phusion Master Mix (NEB). PCR reactions were amplified for 9-11 cycles ...
-
bioRxiv - Synthetic Biology 2022Quote: ... from Broccoli single-stranded DNA sequence (100 ng in 20 μL reaction mixture) amplified using Broccoli forward and reverse primers (0.5 μM) and Phusion® DNA polymerase (NEB). An initial denaturation at 98 °C for 30 sec was followed by denaturation at 98 °C for 10 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... Molecular cloning of the genes encoding BacA-related and YejABEF-related transporters into the pSRK vector [23] was performed either by conventional restriction enzyme digestion and ligation protocol (restriction sites are specified for each gene in the corresponding primer names) or by Gibson Assembly protocol (NEB). For Gibson Assembly pSRK plasmid was PCR-amplified with primers pSRK_GA_F and pSRK_GA_R and treated with DpnI restriction endonuclease (ThermoFisher).
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Plant Biology 2022Quote: ... by PCR based site-directed mutagenesis (SDM) using non-overlapping primers listed in Supplementary Table S1 and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... Tiled 1200 bp amplicons were generated using midnight primers (IDT) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) for 32 cycles (LA-GSU1 to LA-GSU19 ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.2 µM of each primer were amplified with 0.5 units of One Taq DNA polymerase (Biolabs, Ipswich, MA, USA). Cycling conditions were established with an initial denaturation step at 95°C/2 min followed by 40 cycles at 95 °C/45 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... A 517bp product was amplified using the primers specified in Table S4 and S5 and digested with BsaI-HFv2 (NEB) according to the manufacturer’s guidelines before gel electrophoresis of the resulting product on 3% agarose gel ...
-
bioRxiv - Biochemistry 2024Quote: ... were PCR amplified with indicated primers (see Table S1) and inserted into backbone plasmids via restriction digest and ligation (all enzymes from NEB) or Gateway cloning (Thermo) ...
-
bioRxiv - Microbiology 2023Quote: ... the entire region of pET15b-His-sdeA except for the region encoding 1-199 aa of SdeA was amplified with primers 2649/2712 and then the fragment was self-ligated with a Gibson assembly kit (New England Biolabs). For construction of pmGFP-sdeAΔDUB ...
-
bioRxiv - Genetics 2024Quote: QF2-T2A-LexA-GAD ORF PCR-amplified with FRT-QF2-fwd + FRT-lexA-GAD-rev primer pair – used Hot-Start Q5 polymerase with GC enhancer (NEB);
-
bioRxiv - Cell Biology 2024Quote: ... Site directed mutagenesis was used to create an additional Lv165 BMI1 overexpression vectors with a P2A sequence instead of the IRES by designing primers using the New England Biolabs (NEB)-base changer website (https://nebasechanger.neb.com ...
-
bioRxiv - Microbiology 2024Quote: ... the coding regions were amplified with primers listed in Supplementary file Table S1B from chromosomal DNA using Phusion high-fidelity DNA polymerase (NEB) and subjected to restriction enzyme digestion ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were generated from a pENTR cyfip2-EGFP plasmid [32] using custom primers and the Q5 Site Directed Mutagenesis Kit (NEB) to induce the desired C179R (ΔRac1 ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Microbiology 2024Quote: ... The CUP1 promoter sequence was amplified from the iBFG-Y2H vectors (primers oHM487/488) and cloned into N2H N1 and N2 vectors digested with SpeI/SacI using NEBuilder assembly (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Genome PCR products which were confirmed as a single band in AGE were subjected to direct Sanger sequencing after decomposing remaining nucleotides and primers by the treatment with 2U Exonuclease I (NEB) and 0.1U Shrimp Alkaline Phosphatase (NEB).
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Microbiology 2023Quote: ... was generated using primers 2238–2027 The RNAs were synthesized in 50 μl reactions containing T7 RNA polymerase (25 units; New England Biolabs), 40 mM Tris–HCl (pH 7.9) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5µM of NEBNext Unique Dual Index Primers and 25 µL NEBNext Q5U Master Mix (New England Biolabs, Ipswich, MA, USA) were added to the DNA and PCR amplified ...
-
bioRxiv - Microbiology 2022Quote: ... we amplified the gene ctl0382 (homolog of ct127) with a six histidine tag in the reverse primer using Phusion enzyme (NEB), and the PCR product was linked with pBOMBL::L2 linearized by EagI and KpnI using HiFi assembly system (NEB) ...