Labshake search
Citations for New England Biolabs :
2551 - 2600 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed using the Q5® Site-directed mutagenesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... MscS mutants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: cDNA libraries were prepared using a NEBNext Ultra II RNA Library Prep Kit (NEB). RNA and cDNA quality and quantity were evaluated by performing a Qubit assay with the TapeStation 4200 system (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: Chosen residues were substituted with alanine using Q5® Site-Directed Mutagenesis Kit (NEB) according to supplier protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... using primers synthesized by IDT and a Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the Monarch® RNA Cleanup Kit (50 μg) (New England Biolabs) according to the adjusted manufacturer’s instructions for the purification of RNA ≥ 15 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... Mutations on eGFP-ATP7B were prepared following Q5 Site-Directed Mutagenesis Kit (NEB #E0554) protocol.
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... IVT products were purified using a Monarch RNA Cleanup Kit (NEB, T2030L, Ipswich, MA) and stored at -80°C.
-
bioRxiv - Systems Biology 2023Quote: ... The tagmentation process was promptly neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). The samples were then eluted in a final volume of 20 μL using the Elution buffer.
-
bioRxiv - Plant Biology 2023Quote: ... desalted using GenepHlow PCR Cleanup Kit (GeneAid) and ligated with T4 DNA ligase (NEB), each step according to manufacturer’s directions ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified gDNA was subsequently processed using the EpiMark 5hmC Analysis kit (NEB, cat# E3317) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Point mutants were generated using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... and fragments then gel-purified using Monarch® Genomic DNA Purification Kit (NEB: #T3010S). The pBAD33 vector was DpnI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the NEB Monarch DNA Cleanup Kit (NEB, T1030) and eluted with 10 µl of elution buffer.
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared using NEBNext Ultra DNA Library Prep Kit Illumina (NEB) and sequenced on the Illumina HiSeq 2500 platform (PE 50bp) ...
-
bioRxiv - Zoology 2024Quote: ... and pMi{Hau-cif7-ngfp}) were produced using NEBuilder HiFi DNA Assembly kit (NEB). The pMi base plasmid was linearized by double digestion with SpeI and SacII ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gRNAs were synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using the Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Minipreps were performed using Monarch Plasmid Miniprep kit (New England Biolabs, Ipswich, Massachusetts, USA) and PCR products were purified with Monarch PCR and DNA Cleanup kit (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: The mRNA isolation utilized the NEBNext Poly(A) mRNA Magnetic Isolation Kit (NEB, #E7490) with 1 μg of total RNA ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from collected spermatids fractions with Monarch RNA extraction kit (NEB) according to manufacturers’ protocol for RNA extraction from tissue or leukocytes ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Libraries were pooled and sequenced with paired end sequencing on a Novoseq 6000 (Novogene).
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were spin-purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) or the DNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2024Quote: ... RNA samples were purified using the Monarch® RNA Cleanup Kit (New England Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: DNA from positive clones was extracted using a Monarch Genomic DNA Purification kit (NEB). DNA insertion was confirmed by amplification of a fragment including both genomic and kanamycin resistance cassette sequences followed by the sequencing of amplified DNA (Macrogen).
-
bioRxiv - Microbiology 2023Quote: ... RNA was then purified using the Monarch RNA Cleanup Kit (NEB, Cat. No. T2040).
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were constructed using NEBNext library kits (New England Biolabs, Ipswich, MA, USA) and sequenced on a NextSeq 550 sequencer (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon gel extraction following the Monarch® DNA Gel Extraction Kit (NEB, Frankfurt, Germany) instructions was used to isolate and purify the cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The transcripts were purified with a Monarch RNA Cleanup kit (New England Biolabs, USA). The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the cDNA libraries were purified using the Monarch PCR & DNA Cleanup Kit (NEB). High-throughput sequencing was performed on an Illumina NextSeq 550 in paired-end mode with 150 cycles per end.
-
bioRxiv - Molecular Biology 2023Quote: ... transferred to 50 μl DNA/RNA protection buffer (Monarch Total RNA Miniprep Kit, NEB), and stored in liquid N2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal RNA was depleted from total RNA with the rRNA depletion kit (NEB# E6310) and subsequently prepared for RNA-seq with the NEBNext Ultra Directional RNA Library Prep Kit (NEB #E7420 ...
-
bioRxiv - Biophysics 2023Quote: RNA synthesis was performed according to the HiScribe SP6 RNA Synthesis Kit protocol (NEB). Double-stranded DNA sequences containing SP6 promoter 5′ATTTAGGTGTGACACTATAG 3′ were used as DNA matrixes for RNA transcription.
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was preferred ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Biophysics 2023Quote: ... The NEBuilder HiFi DNA Assembly and Q5 site-directed mutagenesis kits (New England Biolabs) were used for plasmid construction ...
-
bioRxiv - Biochemistry 2023Quote: ... All disease variants were introduced using a Q5 site-directed mutagenesis kit (NEB, E0554S).
-
bioRxiv - Molecular Biology 2023Quote: Libraries for ChIP-seq were prepared with NEBNext Ultra II DNA Library kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel purification using the Monarch DNA Gel Extraction Kit (New England BioLabs Inc. #T1020L) was performed to extract the shRNA sequence and column purification with the QIAprep PCR Purification Kit (Qiagen #28104 ...
-
bioRxiv - Immunology 2023Quote: ... followed by the NEBNext Ultra II Directional RNA Library Prep Kit (CAS: E7760S, NEB). Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS ...
-
bioRxiv - Developmental Biology 2023Quote: ... were carried out using the NEBridge Golden Gate Assembly Kit (BsmBI-v2) (NEB, #E1602L), using 75 ng of each part and 2 μl of enzyme mix in a 20 μl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... the PCR reaction was purified using the Monarch PCR Cleanup Kit (New England Biolabs). DNA was sent for Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... we utilized the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2023Quote: ... rRNA depletion was performed with the NEBNext rRNA Depletion Kit v2 (New England Biolabs), and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and processed with the NEBNext Ultra II DNA library preparation kit (New England Biolabs). Sequencing was performed on MiSeq sequencers (Illumia) ...