Labshake search
Citations for New England Biolabs :
2401 - 2450 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from individual colonies (Monarch Plasmid Miniprep Kit, New England Biolabs, #T1010L) and sequenced (Mix2Seq Kit NightXpress ...
-
bioRxiv - Microbiology 2022Quote: ... coli host strain using the Monarch® Plasmid Miniprep Kit (NEB, Ipswich, MA, USA). The extracted plasmid was linearized with restriction enzyme BamHI (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... We cloned each fragment into pMiniT using the PCR Cloning Kit (New England BioLabs), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Total RNA was then isolated using Monarch Total RNA Miniprep Kit (New England Biolabs). cDNA was synthesised from 350 ng of total RNA from each sample using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... mRNA libraries were prepared with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and size selection for libraries was performed using AMPure XP system (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The transcripts were purified using the Monarch® RNA Cleanup Kit (50 μg) (NEB) and verified on a 6% PAA ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: ... rRNA was removed from the total RNA using a NEBNext rRNA depletion kit (NEB), and RNA was converted to a DNA library using a TruSeq stranded total RNA kit (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... point mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The pME_EB3-mScarlet-I was cloned using the Gibson Assembly cloning kit (NEB #E2611S) according to the manufacturer instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was achieved using the NEBNext rRNA depletion kit v2 (NEB, Cat# E7400L), and subsequent end-repair ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Synthetic Biology 2024Quote: ... while Gibson assembly reactions used the NEBuilder(R) HiFi DNA Assembly Cloning Kit (NEB). Transformed bacteria were grown for 24h at 32°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, E2040S), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Small RNA libraries were prepared using the NEBNext Small RNA Library Prep kit (NEB), with some modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the NEB Monarch Total RNA Miniprep Kit (#T2010, New England Biolabs, United Kingdom) respectively ...
-
bioRxiv - Zoology 2023Quote: ... or the Genome Institute of Singapore (GIS) using NEBNext DNA Library Preparation Kits (NEB). Paired-end sequencing was performed on Illumina Miseq (2x300-bp or 2x250-bp ...
-
bioRxiv - Biochemistry 2024Quote: All PCR was performed with Q5 High-Fidelity DNA Polymerase kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... the collected cell pellets were processed using Monarch RNA extraction kit (New England BioLabs). The RNA samples were then quantified with nanodrop and normalized before cDNA synthesis (Lambda Biotechnologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NEB Next® Ultra RNA Library Prep Kit for Illumina (E7530L, NEB, USA) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina HiSeq X Ten or Nova-seq instruments ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was depleted of rRNA using the Illumina rRNA Depletion Kit (NEB #E6310) and then prepared for Illumina sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina #E7760 per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs). qPCR was performed on a LightCycler 480 real time PCR system (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit (NEB) and sequenced on the HiSeq 2500 Sequencing System (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library prep kit (New England Biolabs) following manufacturer’s instructions for H3K9ac CUT&RUN DNA ...
-
bioRxiv - Systems Biology 2024Quote: ... the enzyme’s activity was immediately neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). Subsequently ...
-
bioRxiv - Synthetic Biology 2023Quote: ... after which DNA was extracted using Monarch genomic DNA purification kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Cat. # E2040S), template concentration 10 nM ...
-
bioRxiv - Microbiology 2024Quote: ... The purified products were quantified using the NEBNext Library Quant kit for Illumina (NEB) and sequenced using a mid-output reagent cartridge with 2×150 paired-end reads on an Illumina Miniseq platform ...
-
bioRxiv - Microbiology 2024Quote: ... cells were lysed and RNA purified using the Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer’s instructions except that the on-column DNase treatment was omitted ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted using the Monarch Total RNA miniprep kit (New England Biotechnologies (NEB) #T2010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the library for sequencing was constructed with FS DNA Library Prep Kit (NEB, E7805) by following the manual instructions ...
-
bioRxiv - Genomics 2024Quote: The ligation product was purified using a Monarch PCR & DNA Cleanup Kit (NEB #T1030) following the manufacturer’s recommended protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... pBBR1-E and pBBR-EV were extracted using Monarch Plasmid Miniprep kit (#T1010; NEB) and following supplier’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Genetics 2024Quote: ... immunoprecipitated RNA and 1% input RNA Monarch RNA Cleanup Kit (New England Biolabs, T2047L) was used according to the manufacturers’ instructions ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesis was performed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB). One microliter of oligo d(T)23VN primer (50 μM ...
-
bioRxiv - Immunology 2024Quote: ... and converted into Illumina sequencing libraries with the NEBNext Small RNA Library kit (NEB). Libraries were sequenced on the Illumina NextSeq-550 in the Boston University Microarray and Sequencing Core ...
-
bioRxiv - Immunology 2024Quote: ... Gibson assembly was performed using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). 100 ng/μl of pET770 was co-injected along with a body wall muscle co-injection marker (17 ng/μl ...
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid was blunted by digestion with Quick Blunting™ Kit (NEB, USA) and ligated to re-circularize the plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... All amplified fragments were then combined using Gibson assembly (Gibson assembly cloning kit, NEB) with 20 base pair overhangs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted first using a Monarch® Total RNA Miniprep Kit (NEB T2010) with on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: Deletion of vpr was achieved using Q5 Site-Directed Mutagenesis kit (New England Biolabs) where the majority of the vpr coding sequence was deleted using PCR exclusion (forward - CAGAATTGGGTGTCGACATAG ...
-
bioRxiv - Bioengineering 2023Quote: ... using the Monarch Genomic DNA Purification Kit following the manufacturer’s protocol (New England Biolabs). The targeted region in NEAT1 was amplified by PCR (primers in Extended Data Table 2) ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After gel extraction using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) Gibson Assembly (New England Biolabs ...