Labshake search
Citations for New England Biolabs :
2451 - 2500 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments were amplified using Q5 polymerase (New England Biolabs, NEB). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 2810-bp PCR product was phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... EJ5-GFP insertion was verified by PCR (OneTaq, New England Biolabs). CHO-K1 ATM+ was generated by transfecting a clonal population of CHO-K1 EJ5-GFP with a Cas9:tracrRNA:sgRNA ribonucleoprotein particle (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... all PCR products were generated with Phusion polymerase (New England Biolabs). All plasmids were sequence-verified.
-
bioRxiv - Plant Biology 2022Quote: ... the amplified PCR products were digested using DpnI (New England Biolabs) and transformed into DH5a competent cells ...
-
bioRxiv - Plant Biology 2022Quote: ... the amplified PCR products were digested using DpnI (New England Biolabs) and transformed into DH5a competent cells ...
-
bioRxiv - Cell Biology 2021Quote: ... and used as DNA template for PCR with Phusion Polymerase (NEB) or Q5 Polymerase (NEB ...
-
bioRxiv - Genetics 2021Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs (NEB), M0530 ...
-
bioRxiv - Genetics 2021Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs (NEB), M0530 ...
-
bioRxiv - Genomics 2021Quote: ... The cDNA was PCR amplified with NEB Q5 HotStart polymerase (NEB) using splicing assay primers from IDT (AGACCCAAGCTGGCTAGCGTT forward ...
-
bioRxiv - Immunology 2020Quote: ... PCR-amplified fragments were digested with XbaI and XhoI enzymes (NEB) and cloned into the NheI and SalI sites of pCW57-MCS1-P2A-MCS2 (Hygro ...
-
bioRxiv - Immunology 2020Quote: ... PCR-amplified fragments were digested with NheI and SalI enzymes (NEB) and cloned into the NheI and SalI sites of a pCW57.1 vector ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were digested with restriction enzyme XmaI (New England Biolabs) and ligated with T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR step was carried out by Taq DNA polymerase (NEB) using forward primer identical to the adapter sequence (Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was PCR-amplified using either Phusion (New England Biolabs; NEB), Pfu (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was PCR-amplified using either Phusion (New England Biolabs; NEB), Pfu (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: PCR fragments were digested with BsaI or BsmBI restriction enzyme (NEB) to specific sticky end ...
-
bioRxiv - Immunology 2020Quote: PCRs were performed with Q5 High-Fidelity DNA polymerase (NEB, M0491L) in 8 parallel 50ul reactions with the following cycle conditions ...
-
An atlas of neural crest lineages along the posterior developing zebrafish at single-cell resolutionbioRxiv - Developmental Biology 2020Quote: ... and dla were amplified via high fidelity Phusion-HF PCR (NEB) from 48 hpf AB WT cDNA libraries using primers in the Key resources table ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplified PCR product was then cut using restriction enzymes (NEB) and ligated to linearized vector pGex-6p-1 (GST ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments were PCRs amplified with Phusion DNA Polymerase (New England Biolabs) and were assembled by T4 ligase (New England Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... PCR was conducted using OneTaq 2x Master Mix (New England Biolabs) with forward and reverse primers following the program of 95°C×10min ...
-
bioRxiv - Biophysics 2021Quote: ... a 2.4 mL PCR reaction was performed using Taq polymerase (NEB) in 1X GoTaq buffer to amplify a 25-N-43 DNA ...
-
bioRxiv - Microbiology 2021Quote: ... the two fragments were generated using Phusion PCR (New England Biolabs) by amplifying the TurboGFP open reading frame from the vector pGIPZ (Thermo Scientific Open Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... Circular PCRs were performed with a high-fidelity polymerase (Q5, NEB) followed by digestion with DpnI restriction enzyme (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was amplified by PCR (Q5 High-Fidelity DNA Polymerase, NEB) using primers (RTWhitelist_Fwd/Rev ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All PCRs were performed with Phusion Polymerase (New England Biolabs, USA). All constructs were verified by Sanger sequencing (Microsynth AG ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... Overlapped PCR fragments were generated (Phusion High-Fidelity DNA Polymerase, NEB) and cloned into competent cells with standard In-Fusion HD cloning techniques ...
-
bioRxiv - Biophysics 2022Quote: ... PCR was performed using a LongAmp DNA polymerase (New England BioLabs) following the protocol from the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product and pUltra were digested with XbaI (NEB# R0145S) and BamHI (NEB# R3136T ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using LongAmp Taq 2X Master Mix (NEB M0287S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The eluate was PCR amplified using 2x NEBNext Master Mix (NEB) and pre-mixed primers with unique dual indexes for Illumina sequencing (IDT) ...
-
bioRxiv - Microbiology 2022Quote: ... We used two high fidelity PCR systems—Q5 (NEB cat. M0492), and Platinum SuperFi II (Invitrogen cat ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid-backbone PCRs were restriction digested with DpnI (New England Biolabs) following the manufacturers’ protocol ...
-
bioRxiv - Immunology 2022Quote: ... All PCRs were performed using Q5 High Fidelity DNA Polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were digested with DpnI (New England Biolabs, MA, USA) as indicated by the manufacturer and purified using the EZNA Cycle Pure Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplification was carried out with phusion polymerase (New England Biolabs) according to instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Library was PCR amplified with unique indexes (E7335S, New England Biolabs) for 14 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were digested with the AvrII (CCTAGG) (NEB, Beverly, MA) restriction endonuclease ...
-
bioRxiv - Plant Biology 2022Quote: ... All PCRs were carried out using Q5 high fidelity polymerase (NEB). NEB Stable Competent E ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR reactions contained 5X Q5 reaction buffer (New England Biolabs, UK), Q5® High-Fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR reactions contained 5X Q5 reaction buffer (New England Biolabs, UK), Q5® High-Fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... We performed secondary PCR to add TruSeq barcodes (NEB Q5 HotStart). Libraries were sequenced as paired end 2 × 250 read multiplex runs on a MiSeq instrument.
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were digested with DpnI (New England Biolabs; Ref.: R0176S) to remove circular DNA ...
-
bioRxiv - Genomics 2024Quote: ... Oligos were amplified through multiple PCR reactions (New England Biolabs [NEB] Q5 High-Fidelity 2X Master Mix ...
-
bioRxiv - Genetics 2023Quote: ... PCR fragments were amplified using Phusion DNA polymerase (New England Biolabs) using the generic protocol and 30 s/Kb extension ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR reactions were carried out using Taq polymerase (New England Biolabs) and contained 2.5 µM gene-specific primers that flanked the intron ...
-
bioRxiv - Genetics 2024Quote: ... DNA was PCR amplified with Q5 high fidelity DNA polymerase (NEB). The forward primer MitfaPCR-F binds to the mitfa genomic region upstream of the insertion site and the reverse primer 5’homology_amplify-R binds the p2A region of the insertion cassette ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then amplified with Q5 PCR mix (New England Biolabs) for a total of 16-25 cycles ...