Labshake search
Citations for New England Biolabs :
201 - 250 of 3850 citations for SARS CoV 2 Spike Glycoprotein S2 aa 800 1000 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... coli (NEB). All sequences were confirmed via Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... Coli (NEB) and grown overnight at 37°C in the presence of ampicillin.
-
bioRxiv - Synthetic Biology 2023Quote: ... coli (NEB), and plated onto a custom 30 in x 24 in LBKan agar plate ...
-
bioRxiv - Immunology 2023Quote: ... coli (NEB) were transformed with the ligation reactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli (NEB) and plated on Amp/IPTG/X-gal plates for blue/white screening ...
-
bioRxiv - Microbiology 2023Quote: ... coli (NEB) was used for routine cloning and plasmid production ...
-
bioRxiv - Microbiology 2023Quote: ... coli (NEB) were used for cloning and protein expression studies ...
-
bioRxiv - Cell Biology 2023Quote: ... coli (NEB) were transformed with 2 μL of the BP reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... coli (NEB) were co-transformed with (1 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (NEB), 11-cis-retinal (National Eye Institute) ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (NEB). Protein expression was induced with 1 mM IPTG at 16 °C for 20 hours in mTB (Casein Digest Peptone 12 g/l ...
-
bioRxiv - Immunology 2023Quote: ... coli (NEB), and the DNA of individual bacterial colonies was isolated (Wizard Plus SV Minipreps ...
-
bioRxiv - Genomics 2023Quote: ... coli (NEB) and plasmids were isolated using an E.Z.N.A endo-free plasmid mini kit II (Omega Bio-tek).
-
bioRxiv - Molecular Biology 2024Quote: ... coli (NEB C2529H with additional plasmid coding rare codons and Chloramphenicol resistance ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli (NEB) were used for proteins overexpression and DNA cloning ...
-
bioRxiv - Microbiology 2023Quote: ... coli (NEB) using the standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli (NEB) was transformed with overexpression plasmids encoding E ...
-
bioRxiv - Neuroscience 2023Quote: ... coli (NEB) via heat shock following the manufacture’s transformation protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... coli (NEB) and Plasmid Miniprep Kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... coli (NEB). For expression ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (NEB). Following transformation and overnight growth on Luria Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (NEB). Affinity purification of Strep3-tagged proteins was performed using a Strep-Tactin® Superflow® high capacity FPLC column (IBA Lifesciences).
-
bioRxiv - Biochemistry 2024Quote: ... coli (NEB #C2984H ...
-
bioRxiv - Genetics 2024Quote: ... coli (NEB) was used to clone the expression constructs ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (NEB) as described above for StcE and sialidase ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (NEB) as described above for StcE and sialidase with the exception that expression was induced with IPTG at an OD600 of 0.9 The harvested cells were then lysed using sonication ...
-
bioRxiv - Cancer Biology 2021Quote: ... Precipitated proteins were resuspended in 150 μL of Glycoprotein Denaturing Buffer (New England Biolabs) and incubated at 100 °C for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate was denatured in glycoprotein-denaturing buffer and digested with PNGase (NEB P0704S) to remove N-linked glycoproteins ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Biochemistry 2020Quote: ... 800 units T4 DNA ligase (NEB) and 1X T4 DNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 800 units T4 DNA ligase (NEB) and 1X T4 DNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Proteinase K (800 U/ml) (NEB) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteinase K (BioLabs, 800 units/ml) was added to the digestion buffer stock immediately before use at 1:100 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The Python script by default selects codons with the highest usage frequency for the input organism (E. coli NEB 10-Beta in this study), unless specified problematic sequences are introduced (Supplementary Figure S3B) ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... SNAP-tag (P9310S, NEB), and β-tubulin (abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP tag (NEB, P9310S) or GFP (MPI-CBG ...
-
bioRxiv - Biophysics 2020Quote: SNAP-tag ligands (NEB): SNAP-Cell TMR-star ...
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Cell Biology 2020Quote: ... Glycoprotein denaturation of the cell lysate was performed with 1x glycodenaturing buffer (New England Biolabs) at 95°C for 10 mins ...
-
bioRxiv - Genetics 2019Quote: ... 2012) by removing cbr-Pmyo-2∷gfp∷his-72 UTR by cutting using KpnI and ApaI (NEB). The digested pZZ0031 backbone carrying cbr-unc-119(+ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 800 units/ml (New England Biolabs Inc.) to 950 μl EDTA and incubated at 37 °C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... 800 U/mL murine RNase Inhibitor (NEB) and 3 % (w/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB, #C2987H) by following the manufacturer’s protocol.
-
bioRxiv - Biophysics 2021Quote: ... coli ligase (NEB). The longest product ...
-
bioRxiv - Biophysics 2021Quote: ... coli cells (NEB) and was purified by maxiprep ...
-
bioRxiv - Genetics 2021Quote: ... coli (C2987H, NEB), resultant colonies of which were screened for successful assembly with colony PCR —2 min initial denaturation (95 °C) ...