Labshake search
Citations for New England Biolabs :
201 - 250 of 1760 citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and K723G).49 His/MBP-BRAF NTs were created with standard Gibson Assembly (NEB) procedure in the pET28-MBP vector from the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... MBP-tagged protein was captured by gravity flow affinity chromatography using amylose resin (New England Biolabs). Captured protein was washed with wash buffer (50mM Tris/HCl pH 7.6 ...
-
bioRxiv - Cell Biology 2022Quote: All overexpression constructs with the internally tagged actins were generated by Gibson assembly (New England Biolabs). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR confirmation of endogenously tagged ATR cell lines was performed using NEB Taq DNA polymerase (NEB) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Nextera-tagged primers under standard Phusion or Q5 Polymerase (New England Biolabs). PCR primers used in this study can be found in Supplementary Table 3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a 450 bp long (HAR sequence)) were introduced using the NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) in combination with the sequences produced as gene blocks (IDT ...
-
bioRxiv - Genomics 2020Quote: Plasmids containing H2afz-FKBP.knock-in.BFP and Nelfb-Halo DNA repair templates were synthesized with long homology arms (∼800 bp) by Genewiz FragmentGene and assembled using the NEBuilder HiFi DNA Assembly Cloning kit (NEB E5520S). The Dendra2-RBP1 plasmid and guide were used as previously described10.
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers pM102F and pM102R (Supplementary Table 2) were designed and used in a long-range PCR reaction using the LongAmp® Taq DNA Polymerase (NEB) to amplify 40 ng of genomic DNA following the kit instructions ...
-
bioRxiv - Microbiology 2020Quote: We tested four high-fidelity and/or long-range DNA polymerases in duplicate to evaluate improvements of read length during the amplification step: 1) NEBNext (NEB M0541), 2 ...
-
bioRxiv - Biophysics 2021Quote: ... to obtain a 1080 bp long DNA with 5 bp overhang and was subsequently dephosphorylated with Antarctic phosphatase (NEB, catalog #M0289S). The obtained product was PCR purified using Qiagen PCR purification kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... We then inserted a 232 bp long BGH polyA sequence downstream of the mCherry coding sequence into the NotI-HF®-digested (NEB) plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Neuroscience 2019Quote: ... pCAV-FLExloxP-Flp was incubated with recombinant Cre recombinase (New England Biolabs) and then transformed into DHα bacteria ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.4 µL (16 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 20 µL ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.75 µL (30 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 30 µL ...
-
bioRxiv - Synthetic Biology 2021Quote: The recombinant CBX8-CD was expressed in BL21 (DE3) (New England Biolabs) Escherichia coli cells ...
-
bioRxiv - Biophysics 2021Quote: ... Recombinant M-MuLV reverse transcriptase from the ProtoScript® II kit (NEB) was used to synthesize first strand cDNA from the annealed primer-MS2 RNA mix ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant Lili-Mips were treated with PNGase F (New England Biolabs) to remove the N-linked oligosaccharides ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were generated using HiFi DNA Assembly Cloning Kit (NEB E5520). During cloning procedures ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were constructed using HiFi DNA Assembly Cloning Kit (NEB E5520). electroporation (device) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). The enzymes mentioned were purchased from New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Microbiology 2023Quote: ... His/Strep-Tag was cleaved using enterokinase according to the protocol of the manufacturer (NEB) and GlnA3Mtwas immediately purified from the digestion mix by size-exclusion chromatography as directed by the resin manufacturer (GE-Healthcare).
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Genomics 2022Quote: ... PCR products (∼1.1 kb-long flanking unique sequences on either side of each rDNA locus) were labelled using Klenow Fragment exo- (NEB CAT. M0212L) with either Biotin-16-dUTP (Roche CAT ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Biophysics 2020Quote: mNG-tagged ADRβ2 and EGFR were generating by cloning into the pSNAPf-ADRβ2 backbone (New England Biolabs). mNG was amplified by PCR from mNG-C1 and placed between the EcoRI and SbfI sites of pSNAPf-ADRβ2 (replacing the SNAP tag ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant MBP-Megator fragments were purified with amylose magnetic beads (New England Biolabs) and eluted in Column Buffer supplemented with 10mM Maltose ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15μL of myc-eIF6-bound beads were incubated with/without recombinant GSK3β (NEB) and suspended in cold kinase buffer and incubated at 30°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM CaCl2) at room temperature in the presence of recombinant enteropeptidase (NEB) at 13 U enzyme per mg TMPRSS2 zymogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL molecular biology grade recombinant albumin (rAlbumin) (New England Biolabs B9200S), 0.8 U/µL RiboLock RNase inhibitor (Thermo Fisher Scientific EO0384) ...
-
bioRxiv - Biophysics 2020Quote: ... The 20-helix bundle with hexagonal lattice is based on the M13mp18 7429-nucleotide long scaffold plasmid (p7429) (Bayou Biolabs, Metairie, LA, USA), and was modified using CaDNAno49 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Q5® High-Fidelity 2X Master Mix was used for long PCRs (Product M0492SNew England Biolabs 240 County Road Ipswich, MA 01938-2732). The correct gene products were confirmed by DNA sequencing (BaseClear BV ...
-
bioRxiv - Cancer Biology 2021Quote: ... Gene-specific LA-qPCR analyses for measuring DNA damage were performed using Long Amp Taq DNA polymerase (New England Biolabs, Cat no MO323S). Since amplification of a small region would be independent of DNA damage ...
-
bioRxiv - Genomics 2023Quote: ... four times the number of moles of the AdBcL (L = long) were annealed with 1x T4 DNA Ligase Reaction Buffer (New England Biolabs, Cat. no. B0201S) and heated to 94°C for 3 min ...