Labshake search
Citations for New England Biolabs :
151 - 200 of 1760 citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Genetics 2020Quote: The long fractions (with and without rRNA depletion) were further processed with the NEBNext Magnesium RNA Fragmentation Module (NEB), as described in the manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplicons for long-range sequencing were generated with Q5 High-Fidelity polymerase in 100 uL reactions (New England Biolabs) including500 nM primers and up to 1000 ng genomic DNA using the following PCR protocol ...
-
bioRxiv - Immunology 2021Quote: Purified recombinant CV3-25 IgG was mixed with LysC (NEB) at a ratio of 1μg LysC per 10mg of IgG and incubated at 37°C for 18h with nutation ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Cell Biology 2022Quote: ... purified recombinant PKA proteins (2,500 units/ml, New England Biolabs) along with 100 μM cAMP ...
-
bioRxiv - Developmental Biology 2020Quote: ... Kinase assays were performed using recombinant murine c-Abl (NEB). The amounts of GST-fusion protein to add to the reaction were calibrated using western blots of the purification products with mouse anti-NICD (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant hACE2 protein was digested using EndoH (New England Biolabs) and thrombin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... recombinant proteins were treated with PNGase F (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified recombinant DNA was treated with DpnI (NEB Biolabs) for 3 h ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified recombinant DNA was treated with DpnI (NEB Biolabs) for 3 h ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext Hi-Fi 2x PCR Master Mix (NEB (Ipswich, MA, USA) M0541S) ...
-
bioRxiv - Microbiology 2020Quote: ... and ligation with T4 ligase (Bioconcept) or by Hi-Fi Gibson assembly (NEB). PCR were performed using Phusion polymerase (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: His-SpCas9-GFP was expressed in and purified from BL21 (DE3, NEB, C2527H) bacteria as previously described 47 ...
-
bioRxiv - Microbiology 2024Quote: ... and joined into the linearized vector by Hi-Fi Gibson DNA Assembly (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: GST or GST-tagged SH3 domains were expressed in BL21 (DE3) E.coli (New England Biolabs). Cells were lysed by sonication in presence of lysozyme (Affymetrix) ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns of MBP-tagged fusion proteins were performed using an amylose resin (New England Biolabs). Appropriate amounts of (see Fig ...
-
bioRxiv - Genetics 2019Quote: ... Amplicons were tagged using NEB Next Ultra II DNA Library Prep Kit for Illumina (NEB) with 5 thermal cycles for amplification and subjected to paired-end sequencing on a MiSeq platform using MiSeq Reagent Nano Kit v2 ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... surrounded by two 1kb-long homology arms upstream and downstream of the start codon of MLH1 was generated using Gibson assembly (NEB). An in vitro transcribed sgRNA targeting the region spanning the start codon of MLH1 was generated as previously described (Richardson et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA samples were fractionated into small RNA (< 200 nt) and long RNA (>200nt) using the Monarch RNA cleaner (New England Biolabs). Small RNA libraries were prepared using the Small RNA-Seq Library Prep Kit (Lexogen) ...
-
bioRxiv - Biophysics 2022Quote: ... a site-specific insertion of cysteine at position 287 was achieved in the long L4 loop of Mb4-tFhuA by site-directed mutagenesis (Q5 mutagenesis kit, New England Biolabs). This cysteine-containing Mb4-tFhuA was expressed and purified as described above ...
-
bioRxiv - Genetics 2022Quote: ... DNA of Del1 and Del2 from Family 1 were used to amplify different haplotypic fragments with long-range PCR or TD-PCR (Table S17) adding restriction enzymes (MluI and KpnI, NEB) on the 3’ of primers ...
-
bioRxiv - Microbiology 2024Quote: ... 800 bp-long sequences located upstream and downstream of the Vc flagellins were amplified with Q5 2X master mix (New England Biolabs) and ligated into the restriction site XhoI and SphI in pDM4 followed by transformation of the plasmid into E ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Genetics 2019Quote: ... after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, USA), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... and dephosphorylated using recombinant shrimp alkaline phosphatase (New England BioLabs M0371L). Annealed and phosphorylated oligonucleotides were cloned into linearized and dephosphorylated BPK1520_puroR using T4 DNA Ligase (New England BioLabs M0202L ...
-
bioRxiv - Immunology 2021Quote: ... A similar dilution series of recombinant histone H3 (New England Biolabs) was prepared starting at 1 µg/ml protein ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 mM DTT with 1.5 µM recombinant H3 (New England Biolabs), vehicle or 500 nM recombinant enzyme ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant bacmids were created by transformation into DH10Bac competent cells (NEB), screening on XGAL plates ...
-
bioRxiv - Biochemistry 2024Quote: ... Protease Inhibitors) with recombinant PKA kinase (2500 U/mg, NEB-P600S) and 1 mM ATP overnight at 30°C and 250 rpm ...
-
bioRxiv - Developmental Biology 2022Quote: ... The complete insert region was PCR amplified using Q5 Hi Fidelity DNA polymerase (NEB) and the amplicon sequenced at high coverage using Illumina MiSeq in the Complete Amplicon Next-Generation Sequencing service from the MGH CCIB DNA Core (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were conducted using NEB Phusion Hi Fi Polymerase (New England Biolabs, Ipswich, MA). Reactions were comprised of 4 µl 5X Phusion Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were conducted using NEB Phusion Hi Fi Polymerase (New England Biolabs, Ipswich, MA). Reactions were comprised of 4 µl 5X Phusion Buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C to remove of biotin from non-ligated fragment ends ...
-
bioRxiv - Biochemistry 2020Quote: ... His-SNAP-EB3 proteins were then coupled to SNAP-Cell 647-SiR dye (NEB) by incubation at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... The expression vector pET302/NT-His was digested with EcoR1 restriction enzyme (NEB R0101S) and run on a 1.5 % agarose gel ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 µg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). PCR reactions were performed with the Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... These were used in a PCR reaction with Q5 Hi-Fidelity polymerase (NEB, USA) in combination with the pLuc-GAL5.1 reporter construct previously described 8 as template to produce pLuc-GALΔEGR ...
-
bioRxiv - Genomics 2019Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the NEBuilder Hi Fi DNA Assembly Master Mix (New England Biolabs, Beverly, MA). For the production of lentiviral particles ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-MBP-Cas12a plasmid was transformed into BL21(DE3) cells (New England Biolabs). A single colony was used to inoculate LB media supplemented with 50μg/ml Kanamycin for an overnight culture grown at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... stained in HI buffer containing 5 μM SNAP-Surface Alexa 647 (New England Biolabs) for 15 minutes at room temperature ...