Labshake search
Citations for New England Biolabs :
201 - 250 of 4256 citations for 5 4 Iodophenoxy methyl furan 2 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Immunology 2024Quote: ... 0.5 µl of 2 µM UPA-long and 0.25 µl Phusion Hot Start Flex DNA Polymerase (New England Biolabs) were added to 15.25 µl nuclease-free water ...
-
bioRxiv - Microbiology 2024Quote: ... Next, the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: The 9N_VRA3 adapter oligonucleotide (0139, Supplementary Table 2) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) using the following protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120) before being pooled and then sequenced by Illumina paired-end (2×150bp ...
-
bioRxiv - Molecular Biology 2022Quote: The library for EM-seq was prepared using 200 ng DNA input and the NEBNext Enzymatic Methyl-seq Kit (NEB, E7120S) following the manufacturer’s instructions for a standard insert (370-420 bp) ...
-
bioRxiv - Cancer Biology 2024Quote: EM-seq libraries were prepared from genomic DNA as previously (78) using the NEB Enzymatic Methyl-seq kit (New England BioLabs; P7120L). In brief ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for genome wide DNA methylation profiles were generated from 200 ng of genomic DNA using NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs). These libraries were sequenced on an Illumina NextSeq 2000 to generate 100 bp paired end reads.
-
bioRxiv - Bioengineering 2023Quote: ... The APOBEC3A and BSA materials used were purchased from the NEBNext© Enzymatic Methyl-seq Conversion Module kit from New England Biolabs (NEB). The reaction volume was then scaled down to 15.5 uL and modified from the original deamination protocol from the kit ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were made according to the manufacturer’s directions for the NEBNext Enzymatic Methyl-seq kit (New England Biolabs, Cat. No. E7120S) using the S220 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Genomics 2024Quote: Methyl-CODEC library amplification was performed by adding 25 μl Q5U Hot Start High-Fidelity DNA Polymerase (NEB, Catalog no. M0515) and 5 μl KAPA Library Amplification Primer Mix (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes) and ligation at 16 °C (4 minutes) with 400 U of T4 ligase (New England Biolabs, USA), followed by heat-inactivation at 65 °C (10 minutes) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 µg of each lysate in 2X Laemmli buffer containing DTT/BPB was combined with GlycoBuffer 2 (1X final; NEB, P0704S) and NP-40 (1% final ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... The enriched products were purified and then subjected to enzymatic methylation conversion according to the manual of NEBNext Enzymatic Methyl-seq Conversion Module (NEB, Ipswich, USA).