Labshake search
Citations for New England Biolabs :
151 - 200 of 4256 citations for 5 4 Iodophenoxy methyl furan 2 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Enzymatic conversion of cleaned sequences was done with NEBNext® Enzymatic Methyl-seq Conversion Module (New England Biolabs, E7125), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted similarly to WGBS protocol above and processed using the NEBNext Enzymatic Methyl-seq Kit (NEB E7120S) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... 200ng of cleaned DNA was used as an input for conversion using a Enzymatic Methyl-seq Kit (NEB E7120S) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Genetics 2023Quote: Whole genome DNA methylation sequencing was performed using the NEBNext Enzymatic Methyl-seq (EM-seq) Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... This was followed by two sets of enzymatic conversion steps using the Enzymatic Methyl-seq kit (NEB, Cat# E7120L) to differentiate cytosines from 5mC and 5hmC ...
-
bioRxiv - Cancer Biology 2024Quote: ... EM-seq was performed with 100ng of purified genomic DNA using NEBNext® Enzymatic Methyl-seq Kit (NEB, E7120) and following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of converted methylated DNA were prepared using the NEB Enzymatic Methyl-seq Kit (New England Biolabs Inc., USA) with the EM-seq Index Primers (New England Biolabs Inc. ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Bioengineering 2024Quote: S-R1-R2-H stock (87.5 kDa, 2 - 4 μM) tagged with handle oligos was reconstituted in 1x T4 ligase buffer (NEB) in PBS with 0.05% NP-40 ...
-
bioRxiv - Genomics 2024Quote: ... was mixed with 4 µg gDNA (or a sample from previous blocking/repair step) in 1x NEBuffer 2 (NEB) in a final volume of 20 µL ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Genomics 2021Quote: ... C and 5mC deamination reaction was performed using the APOBEC3A enzyme (NEBNext® Enzymatic Methyl-seq Kit, New England Biolabs) with the following ramping conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated to barcoded adapters (xGen Methyl UDI-UMI Adapters, Integrated DNA Technologies) using concentrated T4 ligase (New England Biolabs) at 16 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each pool was then converted using an enzyme-based conversion to increase the recovery of single cell gDNA compared to standard bisulfite conversion (NEBNext Enzymatic Methyl-seq, New England Biolabs)102 ...
-
bioRxiv - Cancer Biology 2022Quote: A range of 5 to 30 ng of cfDNA was used to generate WMS libraries with NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) per manufacturer instructions.
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Genetics 2023Quote: ... The sheared DNA was then used as a template for libraries prepared with a NEBNext Enzymatic Methyl-seq Kit (EM-seq) (New England Biolabs). We note that our previous attempts to develop a hybridization capture protocol using bisulfite-converted DNA were unsuccessful ...
-
bioRxiv - Genetics 2023Quote: Libraries for 12 samples (Table S1) were prepared using the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs, Massachusetts, USA) following the manufacturer’s large insert libraries protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 cycles on a Covaris E220 focused ultrasonicator and were subsequently processed using NEBNext Enzymatic Methyl-Seq kit (NEB #7120) following the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sheared gDNA was then used to prepare EM-seq libraries using the NEBNext Enzymatic Methyl-seq kit (NEB, #E7120S) following the manufacturer’s standard size library protocol ...
-
bioRxiv - Biophysics 2024Quote: ... Nucleic acid was treated with DNase (NEB), purified using RNA SPRI beads ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: RNA was isolated from leaves 4 and 5 using Trizol and cDNA was synthesized using MuMLV reverse transcriptase (New England Biolabs, Inc.) primed with random hexamers ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pool was then digested with the outer guides M1 and P1 (5 μg plasmid pool, 10 μL M1+P1 Cas9 RNP, 4 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 40 μL incubated at 37°C for 1 hour) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...