Labshake search
Citations for New England Biolabs :
201 - 250 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Microbiology 2024Quote: ... with 5 μl of 5 mM 3’ -desthiobiotin-guanosine triphosphate (DTB-GTP) (NEB product number N0761), 5 μl vaccinia capping enzyme (NEB product number M2080) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 μL of QuickCIP (NEB). The reaction was incubated at 27°C for 20 minutes followed by inactivation at 80°C for 2 minutes ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL BsiWI-HF (NEB, R3553), 3 µL MluI-HF (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL MluI-HF (NEB, R3198), and nuclease-free water to 150 µL at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of XbaI (NEB R0145S) was used to digest 6 μg of the pcDNA3.1-Cas9 vector ...
-
bioRxiv - Genomics 2024Quote: ... 3 µL 10x ThermoPol buffer (NEB), 3 µL H2O and Therminator IX (NEB 10 U/µL ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl of USER (NEB # E7103L) was added for 20 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Developmental Biology 2020Quote: ... act57B sequence: 5’-UCUUCCCCUC-3’ RNA oligonucleotides were end-labeled using T4 Kinase (NEB) with ATP [γ-32P]32 ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was mixed with Klenow Fragment (3′ → 5′ exo−) (NEB, #E6044A) in NEBNext dA-Tailing Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then 3’-end dephosphorylated and 5’-end phosphorylated using T4 polynucleotide kinase (NEB). tRNA library preparation used SuperScript™ IV following the QuantM-tRNA-seq protocol (Pinkard et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Genomics 2022Quote: ... The RNA was capped by adding 0.5 mM of 3’-desthiobiotin-GTP (3’-DTB-GTP) (New England Biolabs), 50 units of Vaccinia Capping Enzyme (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mixed with 3 µl T4 DNA ligase and 3 µl T4 DNA ligase buffer (New England Biolabs, M0202S), and incubated at 25°C overnight (16 hr) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Systems Biology 2020Quote: ... After 3’-end healing with PNK (NEB) in T4 RNA ligase buffer for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... Then 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biophysics 2021Quote: ... 3’-biotinylated λ-DNA (NEB, Ipswich, MA) was attached to the pre-added lipid bilayer surface (DOPC ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2022Quote: ... adenosine addition at 3’ end (NEB, M0212), ligation of Illumina indexed adapters (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB), 9 units of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μl of BSA (New England BioLabs), sterile MilliQ water up to 50 μl and 10 ng of DNA ...