Labshake search
Citations for New England Biolabs :
101 - 150 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Immunology 2024Quote: ... and 1.2 nmol of the puromycin linker (5’-/5Phos/-d(A)21-(C9)3-d(ACC)-puromycin-3’) by the T4 DNA ligase (New England Biolabs) in a 100 µL reaction for 1 hour at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... Adenylation was performed with 3’-5’ Klenow Fragment (NEB M0212L). Adaptors were ligated with NEB Quick Ligase for 10 minutes at 30°C before two rounds of cleanup with homemade beads ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Klenow fragment (3′ → 5′ exo−) (New England Biolabs). Hybridization was performed at 65°C overnight in the pre-hybridization solution containing 6x saline-sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... A-tailing (Klenow fragment (3’-5’ exo–, New England Biolabs), ligation to barcoded adapters (KAPA) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by A-tailing (Klenow 3’-> 5’ exo-, NEB, M0212S). After A-tailing ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼500 bp 5’ and 3’ flanking regions of Tb427.10.12290 (NEB) with primers SMD400/1 and SMD404/5 respectively using (Lister strain 427 ...
-
bioRxiv - Genomics 2023Quote: ... and 7.5 U of Klenow fragment 3’→5’ exo-(NEB), except for input DNA that is degraded (e.g. ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 μL of Klenow Fragment (3’ -> 5’ exo -, NEB M0212L), 5 μL 50% PEG 8000 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Large Klenow fragment 3’-5’ exo- (New England Biolabs). Biotinylated 19x 601 array DNA ...
-
bioRxiv - Genomics 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (New England Biolabs) for 30 min at 37 °C and purified by using a QIAquick PCR Purification Kit ...
-
bioRxiv - Plant Biology 2024Quote: ... and A-tailed using Klenow fragment (3’-5’ exo-; NEB). The truncated Illumina Y-adapter was ligated to the DNA using T4 DNA ligase (Promega).
-
bioRxiv - Genomics 2024Quote: ... and 3 μl of 5′-deadenylase (NEB, Catalog no. M0331S) to the 60 μl end-prepped product ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Molecular Biology 2024Quote: ... was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo-) (NEB, M0212S) and dATPs (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Systems Biology 2024Quote: ... and A-tailed using Klenow HC 3′ → 5′ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... dA-tailing was done using Klenow fragment (3′→5′ exo-, NEB) with deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...