Labshake search
Citations for New England Biolabs :
2401 - 2450 of 10000+ citations for Cortisone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by ligation (T4 DNA Ligase Kit, M0202, NEB) of the resulting products at a 1:3 molar ratio of vector to insert ...
-
bioRxiv - Biochemistry 2024Quote: ... using Qubit DNA HS kit (New England Biolabs, M0494S). The final RP libraries were single-end sequenced with a NextSeq2000 P2 system (Illumina) ...
-
bioRxiv - Bioengineering 2024Quote: ... and Ultra II Directional RNA Library Prep Kit (NEB) to isolate mRNA and perform dUTP directional preparation of the mRNA library ...
-
bioRxiv - Bioengineering 2024Quote: ... Ligations were done with the Quick LigationTM Kit (NEB). NEB® Stable Competent E ...
-
bioRxiv - Bioengineering 2024Quote: ... purified using the Monarch DNA Gel Extraction Kit (NEB), confirmed via Sanger sequencing (Genewiz) ...
-
bioRxiv - Biochemistry 2024Quote: A Q5 Site-directed Mutagenesis Kit (New England Biolabs) was used per the manufacturer’s instructions with the primers in Table S1 and a pET15b-holC plasmid to mutate arginine 128 to alanine in the HolC protein ...
-
bioRxiv - Microbiology 2024Quote: ... purified using the Monarch DNA Gel Extraction kit (NEB) and ligated using T4 DNA ligase (Invitrogen).
-
bioRxiv - Synthetic Biology 2024Quote: ... and subsequently purified (Monarch® RNA Cleanup Kit, NEB). All tailed and untailed mRNA samples were normalized to a concentration of 50ng/µl and quality was assessed via TapeStation RNA ScreenTape Analysis (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using Monarch RNA Cleanup Kit (NEB, T2030S). 100 ng mRNA was aliquoted and stored as input at –80°C ...
-
bioRxiv - Microbiology 2024Quote: ... HiFi DNA assembly cloning kit (New England Biolabs (NEB)) was used according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... HiFi DNA assembly cloning kit (New England Biolabs (NEB)) was used according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: ... or HiScribe T7 ARCA mRNA Kit (New England Biolabs), evaluated spectrophotometrically and by gel electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... or Q5 Site-Directed Mutagenesis Kit (New England Biolabs). To improve PCR yield with the GCrich hα1B template ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... we used Q5 site-directed mutagenesis kit (NEB# E0554S). Primers were designed according to the sites to be scrambled as shown in the table below ...
-
bioRxiv - Cell Biology 2024Quote: ... the Monarch Genomic DNA Purification kit (New England Biolabs) was utilized with 1-2 x 106 cells ...
-
bioRxiv - Microbiology 2024Quote: ... spin purified with DNA clean and concentrate kit (NEB), and sequenced with Plasmidsaurus.
-
bioRxiv - Molecular Biology 2024Quote: The Q5 Site-Directed Mutagenesis Kit (New England Biolabs) was used to introduce the mutations into pET15b plasmid-borne copies of PRX1 and TRX3 genes using pairs of adequate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Monarch® RNA Cleanup Kit (New England Biolabs) was used to purify transcribed RNA strands ...
-
bioRxiv - Microbiology 2024Quote: ... the NEBNext Ultra II DNA Library Prep Kit (NEB) was used according to the manufactu er’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... a Quickchange site-directed mutagenesis kit (New England Biolabs) was used to introduce the F405L and K409R mutations in the HC plasmids of the IgGs to make the bsAbs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genetics 2021Quote: ... Custom inverse complementary adapters that had inverse complementary terminal modifications to ensure unidirectional ligation (3’-T overhang and 5’ phosphorylation) were ligated onto both ends of the respective subsets using the Ultra II Ligation Module (NEB, USA) according to manufacturer’s instructions and purified with 1:1 bead cleanup (Figure 3) ...